Разное

Ст 16 грунтовка характеристики: CT 16. Грунтовка — Ceresit

Ст 16 грунтовка характеристики: CT 16. Грунтовка — Ceresit

Содержание

Грунтовка Церезит СТ 16: технические характеристики, расход, цена

Грунтовка СТ 16 – это универсальный отделочный материал, используя который можно подготовить основание для нанесения фасадных красок, декоративной штукатурки, прочих отделочных материалов. Технические характеристики грунта позволяют использовать его как для внутренних, так и для наружных работ. Грунтование стен существенно продлевает срок эксплуатации отделки.

Области применения

Грунтовкой Церезит СТ 16 чаще обрабатываются бетонные, цементные, гипсовые, гипсокартонные поверхности, стены и полы из минеральных покрытий. Состав подходит для обработки ячеистого бетона, ДСП, известковой отделки, штукатурки.

После нанесения грунта через тонкий слой штукатурки не просвечивается тон основы, поэтому состав используют при финишных отделочных работах.

Поскольку смесь предотвращает проникновение влаги, её используют для обработки стен в ванных и других помещениях с повышенной влажностью.

Наружные стены грунтовочный состав защищает от воздействия атмосферных осадков.

Дополнительно грунтовка Церезит марки СТ16 может применяться в следующих отраслях:

  • обустройство систем по утеплению фасадов;
  • грунтовка армированного слоя перед укладкой декоративной штукатурки;
  • предварительное грунтование поверхности перед покраской акриловыми, водоэмульсионными, масляными лакокрасочными материалами.

У прогрунтованных поверхностей значительно улучшается сцепка и качество нанесения обойных, силиконовых клейстеров.

Свойства

СТ16 – это грунтовка на водно-дисперсионной основе, обладающая следующими свойствами.

  • Повышает сцепку обработанной поверхности с отделочными материалами. Адгезионные свойства смеси объясняются тем, что это кварцевая грунтовка. В составе есть минеральный песок, придающий поверхности шероховатость.
  • Оптимизирует процесс нанесения финишной отделки.
  • Защищает о влаги. Придаёт обработанной поверхность влагоотталкивающие характеристики. Из-за этого обеспечивается оптимальный режим для высыхания декоративной отделки.
  • Имеет глубокую степень проникновения в обрабатываемый материал.
  • Обработанные грунтующей смесью стены остаются воздухо- и паропроницаемыми.
  • Базовый цвет грунта белый, но его можно колеровать. Поскольку СТ16 не просвечивает основание, то нанесённая штукатурка сохранит свой естественный цвет.
  • В состав грунтовки не входят растворители, поэтому он безопасен и экологичен.
  • Используется для внутренних и внешних работ.
  • Грунт готов к использованию, не нуждается в дополнительной подготовке.

Технические характеристики

Характеристика Описание
Цвет Белый.
Консистенция Густая, однородная, без дополнительных включений.
t°C воздуха при нанесении +5…+30°С при относительной влажности не более 80%.
t°C воздуха при транспортировке и хранении +5…+35°С.
Время высыхания 1 слоя 3-6 ч.
Плотность грунта 1,5 кг/дм.куб.
Скорость впитывания грунтовки поверхностью Мин. 0,5 кг/м.кв./час*0,5.
Расход грунтовки на 1м2 От 200 до 500 мл на м.кв., в зависимости от способности обрабатываемого материала к впитыванию влаги.

Грунтование

Прежде чем приступить к нанесению грунтующей смеси, необходимо предварительно подготовить основание. Это обеспечивает качество нанесения отделочных материалов.

Подготовка

Основание нужно проверить на прочность. Оно не должно сыпаться, крошиться или откалываться. Для этого его тщательно простукивают и прощупывают, удаляют непрочные участки и обметают получившиеся щели. Впоследствии их нужно заштукатурить и выровнять. Попутно нужно выровнять всю поверхность основания. Это можно сделать штукатурными смесями СТ29 или СТ24.

После выравнивания основу нужно обезжирить, удалить с неё жирные, масляные и грязные пятна, остатки старой краски и мастики. Перед нанесением грунтующей смеси нужно устранить с основания плесень, грибок, мох, другие образования на стенах. Это можно сделать стальными щётками. После, стены нужно обработать фунгицидами.

Подготовительные работы проходят в несколько этапов.

  1. Для сильновпитывающих оснований (ДСП, гипс, гипсокартон) нужно провести предварительное грунтование смесью СТ17, дать им 4-6 часов на высыхание.
  2. Поверхности, которые не подлежат обработке (двери, окна), нужно оклеить защитным скотчем, чтобы предотвратить их загрязнение.
  3. Если нужно грунтовать поверх гидроизоляции, с момента установки последней должно пройти не менее 3 суток.

Процесс нанесения

Грунт перед использованием не нужно разводить, достаточно тщательно перемешать в заводской таре. Наносится грунтующая смесь кистью в один проход. Слой должен быть тонким и равномерным. Валик для этих целей не используется. В среднем за 3 часа слой грунта высыхает, после этого можно приступать к дальнейшим работам.

Поверхность, покрытая СТ16, устойчива к царапинам, наносимым ребром металлической тёрки.

Если при нанесении грунт случайно попал на не подлежащие обработке поверхности, его можно быстро удалить водой. Засохший состав устраняется с помощью растворителя.

Хранение

Грунтовку Ceresit Ct 16 нужно хранить в заводской герметично закрытой упаковке при t°C от +5 до +35°С не более года с момента изготовления.

Упаковка

Купить грунт Ст16 можно в вёдрах из пластика ёмкостью 5 и 10 л.

Цена

Стоимость 5-литрового ведра грунтовки составляет приблизительно 500-700 р., а 10 л грунта в среднем можно купить за 1050-1400 р.

Где купить?

Есть или аналоги

Заменители у СТ 16 отсутствуют.

Грунтовка Церезит CT 16 — сфера применения средства

Грунт Ceresit ct 16 (Церезит CT 16) применяется перед покрытием декоративным материалом. Дает возможность качественно подготовить поверхность, гарантирует надежное сцепление, долгую эксплуатацию декоративной штукатурки. Материал изготовлен на водно-дисперсионной основе, может применяться как внутри помещения, так и снаружи.

Свойства материала

Грунтовка ceresit ct 16 – универсальная, отлично подходит под использование фасадных красок, декоративной штукатурки. Обладает свойствами:

  • повышает адгезию последующего слоя материалов с основанием, тем самым сцепление с декоративной штукатуркой становится значительно прочнее. Достигнуть этого эффекта позволяет уникальная формула Strong Bond с повышенным содержанием мелкой крошки мрамора, кварцевого песка в составе грунта;
  • среди составляющих компонентов отсутствуют различные растворители, что наделяет ее экологической безопасностью;
  • может колероваться под цвет покрытия. Особенно необходимо это свойство при покрытии разными цветами. Также, грунт CT 16 не допускает просвечивание основания, сохраняя натуральный цвет декоративной штукатурки;
  • упрощает нанесение, снижает расход финишного покрытия;
  • понижает впитывающие свойства поверхностей, создает наилучшие условия сушки декоративной штукатурки;
  • обладает высокой паропроницаемостью;
  • может применяться для работ внутри и снаружи здания;
  • смесь полностью готова к применению, не требует дополнительной подготовки.

Внимание! Церезит СТ16 значительно повышает адгезию за счет составляющего компонента – кварцевого песка, который делает поверхность шероховатой.

Технические характеристики

По цвету грунтовочный материал ст 16 изначально белого цвета. Преимущество в том, что можно добавлять колерующие пигменты в соответствии с инструкцией производителя. По заказу можно сделать грунтовку любого оттенка. Также возможно колеровать грунт самостоятельно, что порой является необходимым при проведении штукатурных работ с цветным покрытием. Рассмотрим подробнее технические характеристики состава:

  1. грунт CT 16 включает в себя акриловые сополимеры с пигментами, минеральные наполнители на водно-дисперсионной основе;
  2. представляет собой однородный густой состав, не имеющую характерного запаха;
  3. плотность средства: 1,5 ± 0,1 кг/дм3;
  4. время высыхания зависит от вешних факторов, но среднее значение от 3 до 6 часов;
  5. рекомендуемая температура применения и хранения: от 5 до 30 градусов выше нуля, относительная влажность не более 80%;
  6. свойство сцепления к бетону – не менее 1Мпа.

Расход средства

В процессе подготовки материалов для обработки основания, стоит учесть нормы расхода на 1 квадратный метр. Чтобы рассчитать нужный объем грунта Ceresit CT 16, учитывают впитывающие свойства обрабатываемой поверхности. В среднем необходимо от 200 до 500 мл на квадратный метр.

Сфера применения грунтовки

Подлежат грунтованию с использованием Церезит ст 16 бетон, цементно-песчаные, гипсовые, цементно-известковые штукатурки, гипсокартонные, древесностружечные плиты, прочные лакокрасочные покрытия.

Так как данный материал не допускает просвечивания цвета основания даже через один слой штукатурки, его часто применяют в финишных отделочных работах. Церезит показан к использованию в помещениях с повышенной влажностью, так как не позволяет поверхности отсыреть. Также гарантирует защиту от действий погодных условий на улице.

Помимо перечисленных областей, грунтовочный материал применяется также:

  • после нанесения основного защитного слоя, применяемого при устройстве систем внешней теплоизоляции стен, фасадов Ceresit WM и VWS;
  • при нанесении грунта на армированный слой перед декоративным материалом;
  • поверх прочных покрытий лаком или краской;
  • при использовании на основании перед покрытием акриловыми, водоэмульсионными, масляными красками.

Внимание! Грунтовка Церезит СТ16 в значительной мере повышает адгезию, качество нанесения клеевых составов. Настолько обширная область эксплуатации делает данную грунтовку востребованной у обычных пользователей и профессионалов.

Подготовка поверхности

Подготовленная поверхность должна отвечать следующим требованиям:

  1. быть хорошо просушенной;
  2. достаточно прочной;
  3. очищенной от жирных пятен, известкового налета, остатка мастики, пыли и загрязнений.

Основание обязательно проверяется на прочность, путем ощупывания, простукивания. При необходимости очистить и обмести. Также подлежат очистке участки, пораженные плесенью, грибком. Для очищения используют стальную щетку, затем обрабатывают фунгицидным раствором CT 99. А для затирки поверхности рекомендуют применять штукатурку CT 29 либо CT 24.

Основания, которые особенно невлагостойкие и могут сильно напитаться водой (штукатурки из гипса, гипсокартон, древесностружечные плиты) первоначально лучше обработать грунтом CT 17.

Защитить элементы, которые не планируется грунтовать малярной лентой, такие как двери, окна.

Нанесение средства

В соответствии с инструкцией грунтовку СТ 16 не требуется разводить. После вскрытия ее достаточно хорошо размешать в той же таре. Наносить состав лучше с помощью кисти ровным тонким слоем, во избежание превышения нормы расхода, образования потеков. Обычно не требуется более одного слоя.

Для полной просушки грунтовки понадобится около 3 часов, затем можно приступать к последующей работе. Чтобы получить желаемый результат, необходимо соблюдать температурный режим +20 градусов и влажность 60%. Если загрунтованная поверхность тщательно просохла, то на ней не останутся царапины от ребражелезной терки.

Не застывшие остатки грунтовочного материала легко удаляются водой. Если грунт успел засохнуть, то погрешности удастся убрать только механически (с помощью УШМ).

Учитывая все рекомендации можно достигнуть качественного и износостойкого результата поверхностей, независимо от того с какой стороны проводились работы.

Грунтовка Ceresit СТ 16 — Клинкер, клинкерная плитка, вентилируемые фасады для дома, вентфасады, Нижний Новгород

Водно-дисперсионная грунтовка для подготовки оснований под нанесение минеральных, акриловых и силиконовых декоративных штукатурок и красок

Для подготовки оснований под минеральные, акриловые и силиконовые штукатурки и фасадные краски.

  • увеличивает адгезию покрытий к основанию
  • придает основанию водоотталкивающие свойства
  • предотвращает просвечивание цвета основания через декоративное штукатурное покрытие
  • паропроницаемая, водостойкая
  • не содержит растворителей, готова к применению
  • пригодна для наружных и внутренних работ
  • упаковка: пластмассовое ведро 5 и 10 л
  • расход: 0,2 л/м2 — 0,5 л/м2

Свойства грунтовки Ceresit СТ 16:

  • может колероваться под цвет покрытия;
  • повышает адгезию покрытия к основанию;
  • облегчает нанесение декоративных штукатурок;
  • снижает впитывающую способность основания;
  • предотвращает просвечивание цвета основания через декоративное штукатурное покрытие;
  • паропроницаемая;
  • пригодна для внутренних и наружных работ;
  • не содержит растворителей;
  • готова к применению;
  • экологически безопасна.

Область применения грунтовки Ceresit СТ 16:

Грунтовка CT 16 предназначена для обработки оснований перед нанесением минеральных, акриловых и силиконовых декоративных штукатурок или красок на стены при внутренних и наружных работах.

CT 16 применяется для обработки бетона, цементно-песчаных, гипсовых и цементно-известковых штукатурок, гипсокартонных и древесностружечных плит, прочных лакокрасочных покрытий, а также армированного защитного слоя при устройстве систем наружной теплоизоляции фасадов Ceresit WM и VWS.

CT 16 содержит мелкий кварцевый песок, придающий загрунтованной поверхности шероховатость, благодаря чему грунтовка значительно повышает адгезию декоративных покрытий к основанию.

Грунтовка выпускается белого цвета. При необходимости она может быть колерована, в т.ч. в соответствии с картой цветов производителя.

Подготовка основания

Основание должно соответствовать требованиям СНиП 2.03.13-88 и СНиП 3.04.01-87, быть сухим и обладать достаточной несущей способностью.

Основание необходимо обеспылить и очистить от загрязнений и веществ, снижающих адгезию грунтовки (жиров, смазочных масел, битума, клея, лакокрасочных покрытий и т.п.). Непрочные участки основания, ослабленный поверхностный слой, цементное молоко необходимо удалить механическим путём.

Участки поверхности, поражённые грибком, водорослями или мхом, следует очистить металлическими щётками и обработать фунгицидным средством CT 99.

Трещины и неровности следует заполнить ремонтной штукатуркой CT 29 не менее чем за 3 суток до нанесения грунтовки.

Сильно впитывающие и чувствительные к влаге основания (гипсовые штукатурки, гипсокартон, древесностружечные плиты) следует предварительно обработать грунтовкой CT 17 и высушить в течение 4-6 часов.

Окна, двери и прочие конструктивные элементы, не подлежащие грунтованию, необходимо укрыть малярным скотчем для предохранения от загрязнения.

Выполнение работ

Перед применением грунтовку следует перемешать.

Грунтовку CT 16 наносят на основание за один проход, равномерным слоем, при помощи кисти.

Внимание! Грунтовку нельзя разбавлять водой и наносить валиком! При работе с грунтовкой следует использовать только нержавеющие инструменты!

Грунтовка высыхает в течение ~ 3 часов (в зависимости от температурно-влажностных условий), после чего можно выполнять дальнейшие работы. Загрунтованная поверхность должна быть устойчива к процарапаванию ребром металлической тёрки.

Свежие остатки грунтовки смываются с инструментов водой. Засохшую грунтовку можно удалить только растворителями или механически.

Рекомендации

Работы следует выполнять в сухих условиях, при температуре воздуха и основания от +5 до +30°C и относительной влажности воздуха ≤ 80%. Все изложенные в техническом описании показатели качества и рекомендации верны при температуре окружающей среды +20°C и относительной влажности воздуха 60%. В других условиях возможно изменение времени высыхания грунтовки.

Примечания

Кроме данного технического описания, при работе с грунтовкой следует руководствоваться общими инструкциями по выполнению строительных работ.

Проектирование и монтаж систем теплоизоляции фасадов зданий Ceresit WM и VWS следует выполнять в соответствии со Стандартом организации СТО 58239148-001-2006.

Приведенные характеристики основываются на практическом опыте и на эксплуатационно-технических испытаниях.

Изготовитель не несёт ответственности за несоблюдение технологии при работе с материалом, а также за его применение в целях и условиях, не предусмотренных данным техническим описанием.

При сомнении в возможности применения материала следует испытать его самостоятельно или проконсультироваться с производителем.

Настоящее техническое описание, а также неподтвержденные письменно рекомендации, не могут служить основанием для безусловной ответственности производителя.

С появлением настоящего технического описания все предыдущие становятся недействительными.

Срок хранения

В прохладном и сухом месте, на поддонах, в оригинальной неповрежденной упаковке — не более 12 месяцев со дня изготовления.

Предохранять от замораживания!

Упаковка

Грунтовка CT 16 поставляется в пластиковых вёдрах по 5 и 10 литров.

Технические характеристики грунтовки Ceresit СТ 16:








Состав CT 16:

водная дисперсия акриловых сополимеров с пигментами и минеральными наполнителями

Внешний вид:

однородная густая жидкость

Плотность:

~ 1,5 кг/дм³

Температура применения:

от +5 до +30°С

Время высыхания:

~ 3 часа

Водопоглощение обработанной поверхности:

≤ 0,5 кг/м²ч½

Расход CT 16:

0,2 — 0,5 л/м² (в зависимости от впитывающей способности основания)

Санитарно-эпидемиологическое заключение №77. 99.10.570.П.001133.07.03

Расход и область применения краски грунтовки Ceresit CT 16

Краска и декоративная штукатурка это простой и недорогой способ украсить помещение и обновить его внешний вид. Косметические ремонты, которые люди часто для этого устраивают, подкупают своей дешевизной и минимальным объемом работы. К несчастью, обычно и эффект от них держится не очень долго. Но сейчас ситуация немного иная. Чтобы продлить срок эксплуатации подобных декоративных материалов, используется немало смесей и растворов. Некоторые из них совсем недешевые, но однозначно стоят своих денег, ведь они дают просто потрясающий эффект. Грунтовка – это именно тот строительный материал, который обеспечит долгую жизнь покрытию и будет держать его свежим и целым длительное время. С грунтовкой Вы можете забыть про неровный слой декоративного покрытия, трещины и осыпание, которые могут испортить весь результат от ремонта. Мы рекомендуем использовать грунт-краску Ceresit СТ 16. Это материал, который проверен временем и многочисленным опытом разных строителей. Если Вам необходима краска грунтовка Сeresit СТ 16, расход и применение описанные в этой статье помогут Вам использовать ее с максимальной пользой.

Применение на Церезит СТ 16

Начнем, пожалуй, с применения. Грунтующая краска Церезит СТ 16 используется на таких минеральных поверхностях как обыкновенный бетон, ячеистый бетон, гипсовые и цементно-известковые штукатурки, гипсокартонные и древесностружечные плиты, и многие другие. Самое важное, чтобы основание было максимально чистым. Только тогда грунтовка сможет проявить себя на полную силу и обеспечить хорошее сцепление основания и декоративного покрытия. Поверхность должна быть идеально ровной и чиста от пыли, грязи, масел, пятен, грибка, мха и прочего. Наносить грунтовку очень легко и просто с помощью кисти. Обычно достаточно нанести один слой. Но, в зависимости от ситуации может понадобиться повторная покраска. Но при этом необходимо учесть, что первый слой должен полностью высохнуть. Грунтовка Ceresit СТ 16 подкупает своими отличными техническими характеристиками, простотой использования и доступной ценой. Ее легко можно приобрести в нашем интернет-магазине Alki.ua.

Расход краски грунтовки Сeresit СТ 16

Чтобы рассчитать, какое количество грунтующей краски необходимо для Вашего случая, нужно знать, сколько уходит грунта на квадратный метр площади. Расход краски грунтовки Сeresit СТ 16: 0,2 – 0,5 л на м2. В зависимости от впитывающей способности основания, этот показатель может колебаться. Чтобы достичь максимального эффекта от использования грунтующей краски, выполняйте работы в пределах температуры от +5 до +30°C и относительной влажности воздуха не более 80%. Тогда грунтующая краска придаст основанию водоотталкивающие свойства, облегчит Вам нанесения декора и увеличит адгезию к поверхности. При температуре +20°С и влажности 60% один слой грунта сохнет 4-5 часов. С грунтовкой Церезит СТ 16 Вы сможете сделать качественную и красивую декоративную отделку как внутри, так и снаружи дома. А мы постараемся предоставить Вам для этого все необходимое.

технические характеристики, расход на м2

Даже новички в сфере строительства и отделки знают, что жилое здание должно иметь не только отличную функциональность, но также большое значение имеет внешний вид и оформление фасада. Очень популярный вариант – это оштукатуренные и окрашенные стены, которые будут долго оставаться привлекательными, если в ходе отделочных работ использовать грунтовку. В наше время есть множество различных грунтовочных составов, такое разнообразие может поставить в тупик и начинающего отделочника, и даже опытного мастера. Одной из качественных, надежных и проверенных является грунтовка церезит, которая имеет несколько модификаций. Данная статья подробно рассмотрит 2 вида грунта Ceresit.

Что такое грунтовочные смеси Церезит

Данные составы являются универсальными, они имеют водно-дисперсионную основу, изготавливаются из синтетических смол, имеют большую популярность, потому что глубоко проникают в обрабатываемые основания, будь то штукатурка, шпаклевка или кирпичная стена. Благодаря их применению улучшаются адгезивные характеристики, а также стены преждевременно не пересыхают, поэтому не образуются трещины, которые могли бы приводить к быстрому разрушению отделки.

Существует несколько разновидностей грунтов Церезит, каждый из видов имеет свои технические характеристики, сферы применения, функциональность, у каждой разновидности различной расход на 1 квадратный метр. Наиболее популярные модификации – это грунтовка церезит ст 17 и ст 16. Кроме этих, изготавливается также марка 19, которая применяется для обработки бетонных зданий, перед их оштукатуриванием. Каждая из модификаций соответствует высоким нормам и требованиям, имеет все необходимые сертификаты, подтверждающие высокое качество.

Ceresit СТ 16

Данный вид грунтовочного состава широко известен среди специалистов в области отделки. Изготавливается этот грунт на водно-дисперсионной основе. Применяется при выполнении внутренних и наружных отделочных работ, наносить эту модификацию можно только на подготовленную основу, перед тем как наносить штукатурку. Благодаря использованию данного грунтовочного продукта можно качественно подготовить обрабатываемое основание, что станет гарантией прочного и надежного его сцепления с отделочным материалом, поэтому покрытие будет функциональным и привлекательным долгие годы.

Где применяется СТ-16

Используется только перед наложением декоративной штукатурки, например, короеда. Сфера применения очень многообразна, можно наносить перед выполнением отделочных работ на такие поверхности:

  •  гипсовые штукатурки;
  •  бетонные основы;
  •  цементно-песчаные и цементно-известковые постройки;
  •  деревянные и гипсокартонные;
  •  различные лакокрасочные покрытия, которые прочно держатся на стенах или потолке.

Помимо всех вышеперечисленных, грунтовку можно также использовать для обработки защитного слоя при обустройстве фасадных изоляционных систем Церезит.

Внимание! Этот вид применяется под декоративную штукатурку, так как в составе имеется очень мелкий кварцевый песок, который делает грунтуемое основание шероховатым. Небольшая шероховатость значительно увеличивает адгезионные свойства декоративного покрытия.

Характеристики и расход СТ 16

Эта модификация изготавливается в белом цвете, но если есть необходимость, можно использовать колеровку, чтобы добиться нужного оттенка, для колеровки может применяться карта цветов, которую предлагает изготовитель. Консистенция однородная, имеет густую структуру, жидкость полностью готова к использованию, не нуждается в разведении или какой-либо другой подготовке. По структуре – это водная дисперсия нескольких акриловых сополимеров, а также в составе имеются минеральные наполнители и пигменты.

Данный грунт глубокого проникновения расходуется по-разному, в зависимости от вида поверхности. Если основание быстро впитывает, то расход будет увеличенным. Обычно расходуется около 200-500 грамм на м2. Наносить состав разрешается при температуре воздуха 5-30 градусов. В зависимости от того, какая температура окружающей среды, будет зависеть, сколько будет сохнуть жидкость. Обычно время высыхания составляет не более 3 часов.

Свойства и преимущества СТ 16

Эта модификация обладает высоким качеством, она одновременно выполняет несколько важных функций, благодаря следующим уникальным свойствам:

  •  существенно увеличивает прочность сцепления основания и штукатурки, благодаря улучшению адгезионных свойств. Показатель адгезии повышается за счет того, что в составе имеется мелкофракционный песок, который делает основу шероховатой;
  •  хотя базовый цвет – белый, однако можно колеровать состав при помощи добавок. Перекрашивать ее особенно нужно, когда наносится цветная декоративная штукатурка. В этом случае, чтобы исключить просвечивание, важно, чтобы цвет грунта совпадал с цветом финишной отделки;
  •  уменьшает показатель влажности той основы, на которую она наносится, благодаря этому достигается наилучший режим высыхания;
  •  в составе отсутствуют синтетические растворители, поэтому продукт является экологически чистым и безопасным для здоровья человека;
  •  жидкость полностью готова к применению, ее не нужно дополнительно подготавливать, она отличается быстротой и простотой нанесения при помощи обычной кисти или валика.

Правила нанесения

Прежде чем наносить грунт, важно тщательно очистить потолок или стены от любых загрязнений, включая пыль и жирные пятна, которые могут уменьшить адгезионные характеристики. Также необходимо удалить все неровности, а если имеется мох или водоросли, то очистку нужно проводить при помощи стальной щетки.

Внимание! Те места, которые не будут обрабатываться грунтовкой, к примеру, проемы дверей, оконные рамы и прочие, важно защитить, например, малярным скотчем.

Перед нанесением грунтующий состав не нужно разводить водой или другой жидкостью, достаточно всего лишь встряхнуть упаковку, и подготовить валик или кисточку. Если в ходе выполнения работы жидкость попала на укладочное покрытие, то ее можно смыть при помощи обычной воды, а после засыхания ее можно удалить растворителем.

Ceresit СТ 17

Эта грунтовка глубокого проникновения является универсальной, поэтому ее можно применять для обработки любых видов внешних и внутренних поверхностей. Технические характеристики грунтовки церезит ст 17 позволяют использовать ее для следующих целей:

  •  для уменьшения показателя влажности основы, перед тем как выполнять поклейку, укладку кафеля или каменной плитки;
  •  укрепления стен перед нанесением слоя штукатурки;
  •  обработки полов перед использованием выравнивающих напольных продуктов;
  •  обработки гипсовой штукатурки или ячеистых бетонных стен;
  •  укрепления основ, на которые нанесены водоэмульсионные или акриловые краски;
  •  обработки деревеснастружечных и гипсокартонных материалов;
  •  перед тем, как окрашивать здание или монтировать теплоизоляционные плиты;
  •  обработки цементно-стружечных, кирпичных построек, а также тех изделий, которые обработаны формальдегидной продукцией.

Многие специалисты считают, что прежде чем поклеить обои, необходимо грунтовать стены. Это мнение оправдано, ведь грунтующая продукция защищает стены от разрушения и улучшает адгезионные свойства.

Характеристики СТ-17

Данная продукция состоит из водорастворимых полимеров и синтетических смол, имеющих желтоватый оттенок. Наносить этот продукт необходимо в температурном диапазоне 5-35 градусов. Чтобы нанесенный слой полностью высох, в среднем необходимо 4-6 часов, этот показатель полностью зависит от температуры. Расход грунтовки на 1м2 зависит от того, насколько быстро основа впитывает влагу. При нанесении в один слой, обычно расход составляет 100-200 граммов на один метр квадратный.

Поставляется продукция в емкостях по 17л, 10л, 5л и 1л. Чем больше объем канистры, тем меньше стоимость одного литра. Так как грунтовка является универсальной, она подходит для обработки стен перед поклейкой теплоизоляционного материала, а также ее можно наносить на утеплительные материалы. Благодаря универсальности грунта Церезит, не нужно приобретать несколько разных грунтующих продуктов. Выпускается два варианта – зимний (морозоустойчивый) и летний.

Одной из важных характеристик этой продукции является значительное улучшение адгезионной способности. Благодаря тому, что данная жидкость глубоко впитывается в обрабатываемую основу, финишная отделка не будет отклеиваться или отваливаться, даже спустя многие годы. Большое число очень мелких частиц, которые имеют связующие свойства, дают возможность продукции склеивать на молекулярном уровне мельчайшие пылинки, песчинки, различные примеси и материалы, благодаря чему поверхность становится не только прочной, но и очень гладкой. Так как эта жидкость не содержит никаких растворителей, она является экологически безопасной для здоровья человека.

Данная смесь отличается от аналогичных продуктов своими антисептическими характеристиками, она защищает от появления грибков и плесени, а также делает обрабатываемые здания защищенными от влагопоглощения. Грунт не уменьшает показатель паропроницаемости, поэтому его можно использовать для нанесения на стяжки, которые оснащены подогревом.

Подготовка поверхности и нанесение СТ 17

Прежде чем применять эту модификацию, каждому будет полезно ознакомиться с нижеследующими рекомендациями. Очень важно ответственно отнестись к подготовке основания. Подготовка включает в себя такие шаги:

  1.  Удаляются все непрочные, осыпающиеся участки при помощи щетки, имеющей стальную щетину.
  2.  Проводится выравнивание, с целью удаления всех наплывов и неровностей.
  3.  Устраняются следы биологической коррозии, плесени, грибков, это делается либо механическим методом, либо посредством обработки специальными веществами.
  4.  Поверхность тщательно очищается от пыли, грязи, жировых пятен, шелушащейся краски, и других частичек, которые будут уменьшать адгезионные характеристики.

После завершения подготовительных работ, желательно через сутки наносить грунтующую жидкость. Перед ее нанесением необходимо взболтнуть канистру, после чего можно обрабатывать площади макловицей, кисточкой, щеткой или валиком. Разрешается покрытие поверхностей несколькими слоями. Прежде чем наносить последующий слой, нужно дождаться полного высыхания предыдущего слоя. Применять смесь важно в сухих условиях, при влажности воздуха не выше 80 процентов. По завершении всех работ, тщательно вымываются все инструменты под проточной водой.

Грунтовка Церезит: свойства, расход, нанесение

Даже начинающему строителю известно, что жилая постройка должна быть не только функциональной, то есть защищать от холода, ветра и сырости, но и эстетичной, что определяется, в первую очередь, декоративным оформлением фасада. Оно подразумевает оштукатуривание и фасадную окраску стен, которую невозможно осуществить без использования грунтовки.  Строительный рынок пестрит разнообразным ассортиментом грунтовок, что ставит в тупик не только начинающих мастеров, но и опытных застройщиков, которые часто сомневаются при выборе наиболее качественной строительной продукции. Основное правило выбора грунтовочного материала гласит, что перед тем, как отправиться на строительный рынок, необходимо четко представить, какие надежды возлагаются на тот или иной грунтовочный материал, и какие строительные задачи он должен выполнять. Чтобы облегчить задачу застройщикам, специалисты предлагают классифицировать грунтовочный материал в соответствии с его предназначением: для металла, дерева, железобетонных поверхностей, универсальную грунтовку и грунты специального назначения. Рынок надежных и качественных грунтовочных материалов, проверенных временем, возглавляет грунтовка Церезит, представленная на рынке в нескольких модификациях, наиболее популярными из которых являются грунтовка Церезит СТ 17 и СТ 16. В настоящей статье мы попытаемся разобраться в достоверности данного утверждения и поможем нашим читателям определиться с выбором качественного грунтовочного материала.

Содержание

  1. Что собой представляет грунтовка Церезит?
  2. Грунтовка Церезит СТ 16: базовые характеристики
  3. Грунтовка Церезит СТ 17: базовые характеристики
  4. Последовательность работ при нанесении грунтовки Церезит СТ 17

 

Что собой представляет грунтовка Церезит?

Практики утверждают, что грунтовка Церезит представляет собой универсальный грунтовочный состав на водно-дисперсионной основе, изготовленный на базе синтетических смол. Многочисленные поклонники продукции Церезит ценят ее за уникальную способность глубокого проникновения в обрабатываемую поверхность, что способствует не только повышению ее адгезивных характеристик, но и предотвращению преждевременного пересыхания грунтовочных смесей с последующим образованием трещин, приводящих к преждевременному разрушению основания. Производитель предлагает несколько разновидностей грунтовочных смесей, каждая из которых обладает уникальными характеристиками и функциональным предназначением. Наибольшим спросом пользуются модификации СТ 17 и СТ 16, характеристики и область применения которых мы рассмотрим далее.

Кроме того, производитель предлагает грунтовку Церезит СТ 19, предназначенную для обработки бетонных поверхностей перед нанесением штукатурки.

Мы надеемся, что информация, представленная в настоящем материале и обладающая высокой практической ценностью, будет для вас полезна, и, вооружившись ею, вы сможете без проблем выбрать и купить грунтовку Церезит.

Грунтовка Церезит СТ 16: базовые характеристики

Известная в широких строительных кругах грунтовка Церезит СТ 16, изготовление которой осуществляется на водно-дисперсионной основе, используется в процессе наружных и внутренних работ и наносится исключительно на основание перед непосредственным нанесением декоративной штукатурки. Применение данной грунтовочной смеси позволяет произвести качественную подготовку обрабатываемого основания, что является залогом прочного сцепления лакокрасочного материала и, как следствие, надежного и долговечного покрытия.

Область применения материала

Область применение грунтовки под декоративную штукатурку, так называют производители модификацию СТ 16, достаточно многообразна и подразумевает нанесение данного грунтовочного состава на следующие виды поверхностей:

  • Бетонных;
  • Цементно-известковых, цементно-песчаных и гипсовых штукатурок;
  • Древесностружечные и гипсокартонные плиты;
  • Прочные лакокрасочные покрытия;
  • А также подразумевает обработку базового защитного слоя в процессе обустройство наружных теплоизоляционных систем фасадов Церезит.

Важно! Отличительной особенностью грунтовки под декоративную штукатурку является вхождение в ее состав мелкого кварцевого песка, придающего загрунтованной поверхности шероховатую структуру. Именно благодаря данному свойству повышаются адгезивные характеристики декоративных покрытий.

Основные  производственные характеристики и расход
  • Грунтовка данной модификации выпускается белого цвета, однако в случае необходимости может подвергаться колеровке под цвет обрабатываемой поверхности, в том числе и в соответствии с картой цветов, предложенной производителем. По внешнему виду представляет собой густую жидкость белого цвета и однородной структуры;
  • Структура грунтовочного состава СТ 16 представлена водной дисперсией акриловых сополимеров, дополненной пигментами и минеральными наполнителями;
  • Оптимальная температура использования грунтовки вариабельна и колеблется в пределах от +5 до +30 градусов;
  • Время высыхания обработанной поверхности не превышает 3-х часов;

Важно! Расход грунтовки Церезит СТ 16 – вариабельный параметр и зависит от впитывающей способности обрабатываемого основания. В среднем данный показатель не превышает 0,2 — 0,5 л/м2.

Свойства грунтовочного состава

Высокое качество покрытия и эффективное выполнение уникальных функций грунтовки Церезит СТ 16 достигается за счет ее свойств, которые заключаются в следующем:

  • Увеличение прочности сцепления поверхности с декоративной штукатуркой достигается за счет повышения адгезивных характеристик обрабатываемого покрытия. Данное условие выполняется за счет вхождения в структуру грунтовки мелкофракционного кварцевого песка, повышающего шероховатость поверхности;
  • Несмотря на то, что базовым цветом грунтовки является белый, уникальные характеристики материала расширяют поле для деятельности строителей и предполагают возможность колеровки, что особенно актуально в случае выбора цветной декоративной штукатурки, сохраняющей свой цвет после нанесения, исключая просвечивание основания;
  • Важное свойство грунтовки данной модификации заключается в уникальной способности снижать влажность обрабатываемой поверхности, что гарантирует достижение оптимального режима высыхания;
  • Повышенная паропроницаемость и отсутствие в составе грунтовки синтетических растворителей, что является гарантией экологической безопасности материала;
  • Полная готовность смеси к использованию, в связи с чем, она не нуждается в дополнительной подготовке и характеризуется легкостью и быстротой нанесения.
Условия нанесения грунтовочного состава

Перед тем, как приступить к нанесению грунтовки, поверхность тщательно очищают от пыли и загрязнений, снижающих адгезивные характеристики. Все имеющиеся на поверхности неровности также подлежат удалению. Участки, покрытые водорослями, очищают стальными щетками.

Важно! Участки, которые вы не планируете обрабатывать грунтовкой, например, оконные рамы, дверные проемы, скройте малярной лентой.

Грунтовочный состав не нуждается в разведении водой. Все, что необходимо осуществить перед нанесением грунтовки – это встряхнуть упаковку. Для нанесения грунтовки подготовьте кисть.

Если грунтовка попала на укладочные покрытия, в свежем виде она смывается водой, а при засыхании – с помощью растворителя.

Грунтовка Церезит СТ 17: базовые характеристики

Как уверяет производитель, грунтовка Церезит СТ 17 – универсальный грунтовочный материал, что позволяет ее использовать для обработки поверхностей, характеризующихся различными физическими свойствами. Чтобы убедиться в этом, достаточно ознакомиться с ее широчайшей областью применения.

Область применения материала
  • Обработка впитывающих поверхностей  для снижения их влажности перед непосредственным монтажом керамической и каменной плитки;
  • Обработка поверхности перед применением штукатурки или выравнивающих напольных смесей, при этом они могут располагаться как снаружи, так и внутри здания;
  • Предварительная обработка поверхности перед покраской здания или монтажом теплоизоляционных материалов;
  • Обработка ячеистого бетона и гипсовых штукатурок;
  • Обработка гипсокартонных и древесностружечных материалов.

Таким образом, данную модификацию грунтовки Церезит, характеристики которой будут рассмотрены далее, можно наносить на следующие поверхности:

  • Бетонные и кирпичные;
  • Акриловую, водоэмульсионную краску;
  • Поверхность пенопласта и пенополистирола;
  • Поверхность материалов, обработанных формальдегидными пропитками, например, ДСП и ДВП;
  • Гипсокартонные поверхности.
  • Древесностружечные, цементностружечные и древесноволокнистые поверхности.
Основные  производственные характеристики и расход
  • Структурный состав грунтовки Церезит СТ 17 представлен водным раствором полимеров, а именно синтетических смол желтоватого цвета;
  • Рабочая температура также вариабельна и находится в пределах от +5 до +35 градусов;
  • Время полного высыхания зависит от условий, при которых оно происходит. В среднем данный показатель не превышает 4-6 часов;

Важно! Расход грунтовки Церезит СТ 17 зависит от впитывающей способности поверхности, подвергшейся обработке и при однократном нанесении составляет 0,1 — 0,2 л/м2.

Свойства грунтовочного состава

Универсальность грунтовки Церезит, цена и качество которой полностью соответствуют, является одним из самых важных для потребителя свойств, позволяющих отказаться от приобретения различных грунтовочных составов для каждого отдельно взятого вида строительных работ. Приобретая грунтовку Церезит СТ 17 в канистрах по 10 л, вы сможете сэкономить не только а материале, но и на его стоимости, так как с увеличением объема упаковки уменьшается цена за литр материала. Если планируете провести небольшой объем отделочных работ, то специалисты рекомендуют приобретать емкости меньшего объема – по 1 или 5 литров.

Если речь идет о наружных работах, например, шпаклевке и покраске заборов или фасадов, специалисты рекомендуют отдавать предпочтение именно грунтовке Церезит СТ 17, именно благодаря ее универсальности. Например, если говорить об утеплении фасадов, мастера знают, что это процесс поэтапный — сначала осуществляют грунтовку поверхности, а затем ее утепление. Чтобы предотвратить разрушение утеплителя, его также грунтуют, оштукатуривают и красят. При этом каждый описанный процесс подразумевает использование грунтовочной смеси. И, в данном случае, очевидно, что лучше приобрести одну универсальную грунтовку Церезит глубокого проникновения и использовать ее на каждом этапе отделки, чем покупать большое количество различных грунтовок. Кроме того, нельзя не отметить, что данная грунтовочная смесь изготавливается в двух вариантах: летняя и зимняя (морозостойкая) версии.

Важно! Опытные мастера утверждают, что в процессе отделочных работ можно задействовать любую шпаклевку, и конечный результат будет зависеть не от ее качества или марки, а от многократной обработки поверхности грунтовочной смесью Церезит СТ 17. Однако, если вы неправильно подберете пропорцию финишной шпаклевки и воды, то, осуществив ее ошкуривание, вы можете заметить ее осыпание на некоторых участках стен. Но если вы не пренебрежете использованием грунтовки Церезит перед непосредственным ошкуриванием поверхности, данных микро нюансов вы сможете легко избежать.

Повышение адгезивной способности покрытия – одно из важнейших свойств грунтовочной смеси. Так как она проникает в обрабатываемую поверхность на молекулярном уровне, финишное покрытие не отвалится и не отклеится.

Грунтовка Церезит глубокого проникновения, так называют производители модификацию СТ 17, характеризуется максимальным количеством сверхмелких частиц компонентов, обладающих связующими свойствами, что позволяет грунтовке связывать самые мельчайшие компоненты, находящиеся на обрабатываемой поверхности – песчинки, пылинки, всевозможные примеси, что позволяет придать поверхности не только высокую прочность, но и абсолютную гладкость.

В составе грунтовочной смеси Церезит СТ 17 отсутствуют растворители, что гарантирует полную экологическую безопасность материала.

Основные защитные функции грунтовки глубокого проникновения
  • Использование грунтовки способствует укреплению обрабатываемых поверхностей и предотвращению их разрушения. Нанося грунтовку на все вида строительных поверхностей, за исключением невпитывающих, вы предотвращаете их преждевременную деформацию;
  • Предотвращение отторжения и разрушения отделочных материалов, наносимых на обработанную грунтовкой поверхность;
  • Защита от плесени, влаги и грибка. В связи с этим, многие мастера утверждают, что ни при каких обстоятельствах нельзя пренебрегать грунтованием поверхности, так как оно является антисептической профилактикой различных повреждений;

Важно! Характеризуя поверхности, обработанные различными грунтовками, строители отмечают, что на гипсокартонной поверхности, обработанной различными грунтовочными составами, наибольшую шершавость, и, как следствие, гидрофобность сохранял участок поверхности, обработанный грунтовкой Церезит СТ 17;

  • Защита обработанной поверхности от пыли. Загрунтовав поверхность данной смесью, вы увидите, как они блестят;
  • При нанесении тонкослойных выравнивающих смесей также рекомендуется использовать грунтовку, так как они предупреждает их высыхание и образование пузырьков на поверхности;
  • Так как грунтовка Церезит СТ 17 не снижает паропроницаемость поверхности, она может применяться для обработки стяжек, оснащенных подогревом.

Последовательность работ при нанесении грунтовки Церезит СТ 17

Несмотря на то, что упрощенная стандартная инструкцию по применению грунтовочного состава размещается производителем на этикетке,  мы считаем, что у каждого вида строительных работ есть свои нюансы и поэтому предлагаем вам внимательно ознакомиться со следующими рекомендациями.

Перед нанесением концентрата грунтовки Церезит на поверхность ее необходимо обработать в следующем порядке:

  • В первую очередь, удаляют непрочные участки с помощью щеток со стальным ворсом;
  • Затем поверхность подвергают выравниванию, в процессе которого убирают все наплывы;
  • Удаляют биологическую коррозию, вызванную грибками или плесенью, что можно осуществить механическим способом или, обработав специальным составом;
  • Далее поверхность очищают от пыли, жировых загрязнений и других мельчайших частиц, которые могут снизить адгезивные свойства грунтовочного состава;

Важно! Подготовка обрабатываемой поверхности в идеале осуществляется за сутки до нанесения грунтовки. Перед непосредственным нанесением канистру с грунтовочной смесью взбалтывают, поле чего наносят состав на поверхность с помощью макловицы (широкой кисти), щетки или валика. При нанесении грунтовки в труднодоступных местах пользуются неширокой кистью.

  • Допускается обработка в два слоя, при этом, при нанесении первого слоя разрешается разбавить грунтовочный состав на 1/3 водой. Если вы осуществляете работу в другом температурном режиме, нежели указанный на упаковке (от +5 до +35 градусов), время высыхания поверхности может меняться.
  • После высыхания обработанной поверхности, проверяют степень ее гигроскопичности (впитывания). В случае необходимости обрабатывают поверхность повторно. Например, ячеистый бетон, обладающий высокой впитывающей способностью, подвергается обработке дважды. При этом первый слой наносится с использованием раствора на 1 часть состоящим из грунтовки и 1 части воды. Последующую обработку осуществляют после полного высыхания первого слоя.
  • Опытные практики рекомендуют альтернативный способ обработки фасадов, подразумевающий нанесение на поверхность грунтовки, после кратковременного подсыхания которой, сразу же наносится фасадная краска. После использования инструменты сразу же промывают водой. Остатки грунтовки также удаляют водой, а в случае ее подсыхания – растворителем.

Важно! Все работы необходимо выполнять в сухих условиях, при относительной влажности воздуха не более 80 %. Технические показатели материала, изложенные выше, совпадают с действительностью при температуре 20 градусов и относительной влажности воздуха 60 %.

Таким образом, грунтовочная смесь Церезит СТ 17 не только эффективно справляется с поставленной перед ней строительной задачей, но и повышает эстетические характеристики поверхности, обеспечивая ее идеальную обработку.

Грунтовка бетоноконтакт СТ19 и состав СТ16. > %

 

 

 

Грунтовка CT19 предназначена, согласно техдокументации, для обработки             гладких, преимущественно бетонных, вертикальных  оснований перед нанесением цементно-песчаных штукатурок и плиточных облицовок. В состав входит мелкий кварцевый песок, который по замыслу должен создать высокую адгезию последующих слоев к поверхности.

Но из  опыта  применения этого материала есть много спорного и  непонятного.  Связано это, чаще всего, с произвольным толкования вышесказанного.

Несмотря на скромный перечень вариантов использования, этим грунтом  чего только не мажут. По принципу – кашу маслом не испортишь. Им обрабатывают пол, перед цементной стяжкой, кирпичную стену, пеноблоки – перед  штукатуркой, гипсокартон и , даже, металл перед креплением плитки.

 

Бетоноконтакт на силикатный кирпич

Бетоноконтакт и железо

 

Вторая сложность применения – это огромное число производителей. Грунт бетоноконтакт  “MAPEI” по своим характеристикам  будет заметно отличаться от контактного  грунта “Оптимист”. Поэтому, применяя неизвестный состав с похожим названием, можно получить совсем неожиданный результат.

Внизу на фотографии далеко не полный перечень этого разнообразия.

 

 

Разнообразие производителей бетоноконтакта

 

Многие забывают ( а может и не знают), что этот состав предназначен для внутренних работ, и некоторые контакт грунты, при малейшем  намокании, снимаются пленкой.

 

Намокание бетоноконтакта

 

Если бы вода попала на ст19, нанесенной на стену, я думаю, был бы тот же результат, что и на стяжке.

Чтобы разобраться во всех противоречивых мнениях по этому  составу,  необходимо внимательно изучать  техническую документацию и ответы представителей техотделов , а также отзывы опытных  мастеров по применению бетоноконтакта (желательно только  факты, без фантазий и шизы).

Когда в техдокументации СТ19 указано  “перед нанесением  цементно-песчаных               штукатурок” – то Церезит имеет в виду своих штукатурок –  СТ24  и СТ 29 , с добавками, которые придают  высокую адгезиею к основаниям. А не обыкновенного цементно – песчаного раствора, приготовленного на месте.

 

Какую грунтовку использовать?

 

 

Нанесение бетоноконтакта.

 

Бетоноконтакт можно наносить кистью, валиком, пистолетом для нанесения штукатурки и , даже, шпателем, с последующей раскаткой валиком (для СТ 16). Поэтому расход его колеблется в таком широком  диапазоне  0.3 – 0.75 кг/м2.

 

Нанесение бетоноконтакта валиком

 

 

Механизированый способ нанесения контакт грунта

 

Но у Церезит способы нанесения  ограничены механизированным способом и кистью. С чем это связано сказать трудно. Есть такой ответ:

 

 

Рекомендации от Церезит по нанесению бетоноконтакта

Утверждение спорное. Это может касаться одного какого-то типа валика или особенностей того, кто это выполнял.

Нанесение грунтовки СТ 16 под декоративную штукатурку, широким шпателем ускоряет процесс, а последующая прокатка валиком дает шероховатую структуру. Но для этого нужна ровная поверхность, как на утепленном пенопластом фасаде. Хотя, узкий шпатель на менее ровной плоскости, тоже может дать неплохой результат.

 

 

Нанесение СТ 16 с помощью шпателя

 

Бетоноконтакт для наружных работ.

 

Бетоноконтакт для наружных работ – это грунтовки под декоративные штукатурки. Их можно применять как внутри так и снаружи здания. У Сeresit  это СТ16. У иных производителей могут быть другие обозначения. Но свойства похожие. Если этот состав не боится воды и смены температур, то  он должен  вызывать  больше доверия.

Но его  рекомендуют с опаской где-либо, кроме прямого назначения.  Хотя есть положительный опыт использования ст16 вместо ст19 на гладкой бетонной стене сан кабины.

 

СТ19 или СТ 16. Что лучше?

 

 

Возможно,  по своим характеристикам,  Церезит СТ16  более ближе к составу от Мапей, озвученного в видеоролике ниже, чем к бетоноконтакту. Точнее это можно узнать только тестированием.

 

Бетоноконтакт в ванной комнате и влажных помещениях.

 

На вопрос,  можно ли применять бетоноконтакт в санузлах и других влажных помещениях представителя техотдела отвечают осторожно:

 

Бетоноконтакт в ванной комнате

 

Хотя есть опыт, утверждающий  противоположное:

 

СТ 19 во влажных помещениях

 

 

В следующем видео, скорее всего, и был нанесен бетоноконтакт на краску с последующей штукатуркой. Краска частично сцепилась со штукатуркой – значит что-то было нанесено на краску. Но даже, если бы создали правильный контакт с помощью клея СМ17, то все равно, этот пирог отвалился бы, но уже по слою гипса.

      Бетоноконтакт  на известь и краску.

 

Еще забывают , что бетоноконтакт  нужно наносить на прочное и очищенное от пыли, грибка и лакокрасочных покрытий основание.

Известковая побелка и масляная краска не могут быть основанием, на которое можно наносить контакт грунт.

 

Бетоноконтакт и известковая побелка

 

Хотя, в интернет магазинах можно встретить и такие рекомендации:

 

 

Бетоноконтакт на краску

Краска на полу и бетоноконтакт

 

 

Бетоноконтакт на старую  плитку.

 

В техдокументации нигде не сказано, что бетоноконтакт можно наносить на старое плиточное покрытие.

 

Церезит СТ19 на старую плитку

 

Бетоноконтакт перед укладкой плитки.

 

Спорно, также, мнение, что  поверхность перед укладкой плитки необходимо обрабатывать  бетоноконтактом. Некоторые производители об этом предупреждают:

 

 

Какой вывод можно сделать? Нужен ли вообще бетоноконтакт?

 

Трудно сказать, где его можно применить, после всего прочитанного.

На гладкой бетонной стене  бетоноконтакт не дает того  контакта, который  можно достичь с помощью промазки плиточным клеем. Возможно, некоторые образцы  и можно применять перед выравниванием бетонной поверхности штукатурными смесями СТ29 и СТ 24.

 

Так бетоноконтакт или клей?

 

То, что сейчас грунтовка  “Церезит СТ19” заменила, применяемые ранее, пристреленную сетку и насечки – спорное утверждение. Может и заменила, но не дало той надежности в креплении. Пластичный плиточный клей, я согласен, можно сравнивать в  подобных  ситуациях, но не бетоноконтакт.

 

 

Так Ceresit СТ 19 или Ceresit СТ17

 

Мой вывод полностью совпадает с выводами, сделанными  в следующем ролике:

 


Оптимизация праймеров для ПЦР, нацеленных на бактериальный ген рибосомной РНК 16S | BMC Bioinformatics

Ограничения проблемы

Как указано в предыдущем абзаце, оптимальная пара наборов праймеров должна одновременно максимизировать эффективность и охват и минимизировать смещение сопоставления. Далее мы описываем, как мы количественно кодировали эти ограничения.

Эффективность

Идеальные пары наборов праймеров должны удовлетворять нескольким ограничениям, направленным на повышение эффективности и специфичности ПЦР [7].Однако одновременное выполнение всех ограничений часто непрактично, и большинство современных праймеров нарушают одно или несколько ограничений [16]. Поэтому мы решили ввести эффективность как показатель оптимизации, закодировав многие ограничения как функции нечеткой оценки. Точнее, мы определили нашу оценку эффективности как сумму десяти оценок: семь нечетких оценок, связанных с ограничениями эффективности одного праймера, усредненных по всем праймерам в парах праймер-набор, плюс три члена оценки, относящиеся к эффективности пары наборов праймеров в целом.Поскольку все термины должны варьироваться от 0 до 1, оценка оптимизации варьируется от 0 (минимальная эффективность) до 10 (максимальная эффективность).

Вообще говоря, наша нечеткая оценка учитывает 1 для каждого ограничения, которое полностью удовлетворяется, или, альтернативно, значение от 0 до 1 в зависимости от того, насколько близко праймер находится к пределу ограничения. В качестве примера рассмотрим температуру плавления праймера T м . T m должно быть больше или равно 52 градусам в идеальной грунтовке [7], но 51 все еще терпимо, хотя и не идеально.В этом случае наша функция нечеткой оценки присваивает 1 температурам 52 градуса или выше, 0 температурам 50 градусов или меньше и учитывает линейную возрастающую функцию между 50 и 52 градусами. Каждый термин подробно описан ниже.

Семь терминов с одним праймером:

  1. 1.

    Температура плавления : температура плавления T m грунтовки вычисляется по формуле ближайшего соседа [17].Член оценки равен 1, если T m ≥ 52, 0, если T m ≤ 50 и ( T m 50) / 2, если 50 52.

  2. 2.

    GC-content : GC-content представляет собой фракцию f GC пар оснований в последовательности праймера, равную либо G (гуанин), либо C (цитозин).Срок оценки — 1, если 0 . 5 ≤ f GC ≤ 0 . 7, 0 если f GC > 0 . 7 или f GC < 0 . 4 и (0 . 5 — f GC ) / 0 . 1, если 0 . 4 ≤ f GC < 0 . 5.

  3. 3.

    Стабильность на 3′-конце — член оценки 1 : определены два члена оценки, относящиеся к стабильности 3 -конца. Первый член равен 0, если последние три основания праймера полностью состоят из As (аденины) и Ts (тимины), и 1 в противном случае.

  4. 4.

    Стабильность на 3′-конце — член оценки 2 : второй член оценки равен 0, если последние 5 оснований содержат более 3 C или G, и 1 в противном случае.

  5. 5.

    Гомополимеры : гомополимер представляет собой последовательность идентичных нуклеотидов. Член оценки равен 1, если нет гомополимеров длиной более 4 нуклеотидов, 0,5, если нет гомополимеров длиной более 5 нуклеотидов, и 0, если в последовательности присутствует по крайней мере гомополимер длиной более 5 нуклеотидов.

  6. 6.

    Самодимеры : наличие самокомплементарных участков между парами идентичных праймеров может привести к образованию самодимеров. Учитывая максимальное количество совпадений в выравнивании без зазоров между праймером и его обратным дополнением, max M , член оценки равен 1, если max M ≤ 8, 0, если max M 11 и (11 — макс M ) / 3 если 8 <макс M < 11.

  7. 7.

    Шпилька : шпилька может быть сформирована при наличии самокомплементарности в последовательности праймера, особенно на ее 3 -конце. Член оценки равен 0, если по крайней мере для одного выравнивания без пробелов между праймером и обратным комплементом его 3 -конца совпадают как последний нуклеотид, так и 3 или более из 4 предшествующих нуклеотидов, и 1 в противном случае.

Термины для оценки трех пар наборов праймеров определены следующим образом:

  1. 1.

    Диапазон температур плавления : диапазон температур плавления Δ T м пары праймер-набор рассчитывается как максимум минус минимум температур плавления всех праймеров в заданной паре. Член оценки равен 1, если Δ T м ≤ 3, 0, если Δ T м 5 и (5 Δ T м ) / 2 если 3 < Δ T м < 5.

  2. 2.

    Димеры : мы рассматриваем максимальное количество совпадений max M для всех возможных выравниваний между всеми возможными комбинациями прямого и обратного праймеров из пары набора праймеров. Член оценки равен 1, если макс. M ≤ 8, 0, если макс. M 11 и (11 — макс M ) / 3, если 8 <макс M < 11.

  3. 3.

    Диапазон длин ампликонов : из-за известного снижения эффективности ПЦР с увеличением длины ампликона [7] мы хотим, чтобы длины сгенерированных ампликонов находились в узком диапазоне. Мы особенно хотим избегать ампликонов, которые намного короче целевой длины, поскольку они будут чрезмерно усилены по сравнению с другими. Однако мы хотим иметь возможность допускать небольшую долю выбросов, чтобы избежать штрафов за потенциально ценные пары наборов праймеров из-за всего лишь нескольких редких последовательностей.Учитывая репрезентативный набор бактериальных последовательностей 16S, который с этого момента называется «эталонным набором», мы рассматриваем разницу Δ amplen между медианой и первым процентилем длин ампликонов для всех возможных ампликонов, сформированной путем сопоставления всех комбинаций прямых и обратные праймеры из набора пары с эталонным набором. Член оценки равен 1, если Δ амплен ≤ 50 нуклеотидов, 0, если Δ амплен 100 и (100 Δ амплен ) / 50, если 50 < Δ амплитуда <100.

Выбор критериев оценки и порога по умолчанию основан на предшествующей литературе [7, 18, 19]. Однако и пороги, и интервалы допуска нечеткости могут быть установлены пользователем иначе, чем по умолчанию и в соответствии с его / ее экспериментальными потребностями, указав желаемые значения в качестве входных параметров при вызове инструмента командной строки.

Охват

Оценка охвата определяется как количество последовательностей 16S, совпадающих по крайней мере с одним праймером.Учитывая последовательности праймера и бактериального 16S, мы определяем seed, , последние 5 нуклеотидов на 3 -конце праймера, и мы считаем, что последовательность 16S соответствует праймеру, если область последовательности 16S существует то, что i) точно соответствует семени праймера; и ii) остаток праймера с не более чем двумя несовпадениями [20]. Последовательность 16S из эталонного набора считается покрытой парой набора праймеров , если по меньшей мере один прямой и один обратный праймер в паре набора праймеров соответствуют последовательности.Поскольку эффективность ПЦР уменьшается с увеличением длины ампликона, мы налагаем дополнительное ограничение: учитывая пару наборов праймеров и эталонный набор последовательностей 16S, мы оцениваем длину целевого ампликона как медиану длин всех ампликонов, полученных путем сопоставления всех комбинации прямого и обратного праймеров из пары наборов праймеров с эталонным набором. Затем мы считаем не охваченными все референсные последовательности 16S, длина ампликона которых отличается более чем на 100 нуклеотидов (длиннее или короче) от длины мишени.

Смещение сопоставления

Учитывая контрольный набор последовательностей 16S и пару наборов праймеров, третий показатель оптимизации измеряет вариабельность количества комбинаций прямого и обратного праймеров, соответствующих каждой контрольной последовательности 16S. Вариабельность охвата из-за систематической ошибки совпадения должна быть минимизирована или, по крайней мере, учтена, когда исследование предназначено для количественной оценки относительной численности различных видов бактерий, из-за смещения амплификации в сторону видов, охваченных большим количеством комбинаций прямых и обратных праймеров.В качестве меры смещения сопоставления мы используем коэффициент вариации охвата целевых последовательностей, вычисляемый как стандартное отклонение от среднего числа комбинаций, соответствующих каждой последовательности.

Контрольный набор последовательностей 16S, подготовка и аннотация

Для оптимизации трех приведенных выше оценок мы полагаемся на репрезентативный набор бактериальных последовательностей 16S, извлеченных из общедоступной базы данных последовательностей 16S, GreenGenes [4]. База данных последовательностей GreenGenes 16S организована в виде операционных таксономических единиц (OTU), которые представляют собой вложенные кластеры последовательностей в базе данных, организованные на разных уровнях межкластерного сходства.Для каждого уровня сходства с каждым кластером связана эталонная последовательность, максимально похожая на все другие последовательности в том же кластере [4]. Таким образом, набор эталонных последовательностей можно рассматривать как репрезентативное подмножество всей базы данных последовательностей, становясь все более и более точным для увеличения уровней межкластерного сходства (и, таким образом, количества эталонных последовательностей). Мы выбрали уровень межкластерного сходства 85% в качестве хорошего компромисса между репрезентативностью и сложностью, что соответствует набору из 5088 репрезентативных последовательностей, которые будут использоваться для оценки критериев оптимизации.

Таксономия GreenGenes, хотя и очень чувствительная при аннотировании доменов бактерий и архей, не предназначена для различения последовательностей, принадлежащих эукариотам или вирусам. По этой причине мы решили повторно аннотировать бактериальные последовательности 16S, используя исходную таксономию NCBI [21], чтобы точно идентифицировать среди репрезентативных последовательностей только те, которые принадлежат домену Bacteria. Поскольку информация о домене отсутствует в аннотации NCBI примерно для 20% последовательностей, мы разработали специальную процедуру для выявления среди них бактериальных последовательностей.Процедура подробно описана в Дополнительных материалах (см. Дополнительный файл 1). Мы консервативно решили рассматривать только последовательности, аннотированные как бактерии, как в нашей тщательно подобранной аннотации на основе NCBI, так и в исходной аннотации GreenGenes. В результате был получен набор из 4573 репрезентативных последовательностей 16S, принадлежащих домену Bacteria.

Алгоритм оптимизации

Поскольку проблема выбора оптимальных праймеров требует одновременной оптимизации различных конкурирующих оценок, ее можно представить как многоцелевую задачу оптимизации, где пространство поиска представляет собой набор всех возможных пар праймеров и наборов функция оценки или критерий оптимизации может быть определена так, чтобы максимизировать эффективность и охват и минимизировать смещение сопоставления.Когда необходимо оптимизировать одновременно несколько критериев, но цели, которые необходимо оптимизировать, противоречат друг другу, обычно интересует не одно решение, а набор оптимальных решений Pareto , т. Е. Набор решений, для которых Ни одна из целей не может быть улучшена без ущерба для хотя бы одной другой цели [22]. Результатом многоцелевой оптимизации больше не является уникальная оптимальная пара наборов праймеров, как при одноцелевой оптимизации, а скорее набор пар наборов праймеров, которые не хуже любой другой пары наборов праймеров и строго лучше хотя бы по одному из критериев.Точнее, для задачи оптимизации с тремя целями, заключающейся в максимизации оценок оптимизации эффективности (E) и охвата (C) и минимизации оценки систематической ошибки соответствия (M), как определено в предыдущем разделе, оцениваются пары кандидатов праймеров. согласно вектору целевой функции f = ( f E ; f C ; f M ). Учитывая две пары наборов праймеров p и p ‘, мы говорим, что p доминирует над p’ ( p ≺ p ‘) тогда и только тогда, когда f ( p ) f ( p ′ ), f E ( p ) ≥ f E ( p ′ ), f C ( p ) ≥ f C ( p ′ ) и f M ( p ) ≤ f M ( p ′ ).Если не существует p ‘, такого что p’ p , пара наборов праймеров p называется оптимальным по Парето . В этом контексте целью выбора оптимальных праймеров является определение (или аппроксимация) набора всех пар парето-оптимальных праймеров-наборов, чье изображение в трехцелевом пространстве называется фронтом Парето [22].

Для поиска оптимального фронта Парето мы полагаемся на двухэтапный итеративный подход локального поиска наилучшего улучшения, предложенный Dubois-Lacoste et al.[23] и эффективно используется в Sambo et al. [24] и Borrotti et al. [25] для оптимального многоцелевого дизайна экспериментов.

Локальный поиск начинается с начального решения и итеративно уточняет его, применяя небольшие локальные изменения и каждый раз оценивая их влияние на качество решения; он останавливается, когда никакие дальнейшие локальные изменения не могут улучшить решение. Процесс повторяется с нескольких различных начальных точек, и возвращается лучшее из когда-либо найденных решений как приближение к неизвестному оптимуму [26].Распространенное расширение локального поиска на многокритериальный случай состоит в том, чтобы начать с набора начальных решений Парето, выбрать одно решение спереди, оптимизировать с помощью локального поиска случайную скаляризацию задачи, то есть линейную комбинацию оптимизации оценки с весами, выбираемыми равномерно случайным образом из единичного симплекса, обновляют фронт Парето и повторяются до тех пор, пока не будет выполнено условие завершения [23].

Процедура MULTI-OBJECTIVE-SEARCH, псевдокод которой описан ниже, получает в качестве входных данных требуемый диапазон длин ампликонов ( диапазон амплен ), репрезентативный набор последовательностей 16S ( повторений ), начальный набор (возможно, вырожденных) пар праймеров ( init ) и количество перезапусков ( n res ).Процедура начинается с выбора из init всех возможных пар праймеров с желаемой длиной ампликона, длиной праймера (от 17 до 21 нуклеотида) и доменом-мишенью ( Bacteria или Universal ).

Вырожденные пары праймеров преобразуются в невырожденные пары наборов праймеров и добавляются в архив. Затем процедура повторяется n отдых раз, каждый раз выбирая случайную пару наборов праймеров p начало от фронта Парето и случайный вектор α относительных весов для оценки оптимизации с равномерной выборкой весов из единичного симплекса; процедура затем решает скаляризацию многокритериальной задачи, т.е.е. задача с одной целью, в которой линейная комбинация трех объективов с относительными весами α максимизируется и добавляет результат в архив. С этой целью оценки эффективности, охвата и смещения сопоставления нормализуются до максимального значения, так что каждый нормализованный балл находится в диапазоне от 0 до 1, а смещение сопоставления переопределяется как 1 — смещение сопоставления, чтобы его можно было максимизировать как другие оценки.

МНОГООБЪЕКТИВНЫЙ ПОИСК (диапазон amplen ; repset; init; n rest )

1 Выбрать все (возможно) вырожденные пары праймеров из набора init с длиной ампликона в диапазоне amplen

2 Добавить в архив соответствующие невырожденные пары наборов праймеров

3 для r = 1 до n остальные

4 pf = PARETO-FRONT ( архив )

5 Образец p начало из pf

6 Образец α из [0 , 1] 3 , с Σ i α i = 1

7 p = LOCAL-SEARCH ( p start , 9036 1 α , набор повторений )

8 Добавить p к архиву

9 возврат архив

Одноблочная оптимизация достигается с использованием алгоритма локального поиска лучшего улучшения [26]: из исходной пары наборов праймеров алгоритм LOCAL-SEARCH циклически перебирает праймеры пары наборов и для каждого праймера сканирует его соседство , т.е.е. набор всех возможных локальных возмущений грунтовки. Локальные возмущения состоят во всех возможных переворотах одного нуклеотида (с оценкой трех других возможных оснований) и всех возможных добавлениях и удалениях одного нуклеотида на концах. Поиск в пространстве решений выполняется с использованием подхода локального поиска наилучшего улучшения : после генерации всей окрестности, как объяснено выше, алгоритм выбирает возмущение наилучшего соседа, начинает с него для генерации следующей окрестности и повторяется до тех пор, пока не достигает решение, для которого не может быть найдено лучшего возмущения соседей.Процедура завершается, когда никакие дальнейшие локальные улучшения не могут быть применены к любому праймеру в паре набора праймеров. Функция WEIGHTED-SCORE вычисляет три оценки оптимизации из пары наборов праймеров и репрезентативного набора, умножает оценки на относительные веса α и возвращает сумму результатов.

Мы разработали программный инструмент, реализующий наш подход, и выпустили его под Стандартной общественной лицензией GNU как программный инструмент mopo16S (Оптимизация многоцелевого праймера для экспериментов 16S) по адресу http: // sysbiobig.dei.unipd.it/?q=Software#mopo16S. mopo16S реализован как многопоточный инструмент командной строки C ++; программный инструмент основан на эффективных алгоритмах и структурах данных из библиотеки SeqAn [27] и использует библиотеку openMP [28] для многопоточности.

LOCAL-SEARCH ( p start , α , repset )

1 p best = p curr = p начало

2 балл лучший = балл curr = взвешенный балл ( p curr , α , повторный набор )

3 при улучшении

4 для i = от 1 до | p curr |

5 pr i = i -й праймер p curr

6 для p новый = p curr со всеми возможными добавлениями и удалениями основания на концах и заменами основания пр i

7 баллов новый = ВЗВЕШЕННЫЙ ОЦЕНКА ( p новый , α , повторная установка )

8 if оценка новый > оценка лучший

9 p лучший = p новый

10 балл лучший = балл новый 9 0016

11 p curr = p best

12 доходность p curr

Современные пары праймеров в качестве начальных решений

Мы выбрали онлайн-базу данных probeBase [15, 16] в качестве источника кандидатных пар наборов праймеров, которые будут использоваться mopo16S в качестве начальных решений.База данных содержит более 500 пар (возможно, вырожденных) праймеров и отчеты для каждого праймера, его последовательность, цепь и положение, в котором он соответствует эталонному гену Escherichia coli 16S , и целевой домен, для которого он разработан (либо Бактерии, археи или универсал).

Учитывая желаемый диапазон длины целевого ампликона в качестве входных данных mopo16S, мы выбрали все пары праймеров из базы данных probeBase, удовлетворяющие всем следующим свойствам:

  • Длина ампликона в желаемом диапазоне;

  • Длина обоих праймеров больше или равна 17 нуклеотида и меньше или равна 21 нуклеотида;

  • Бактерии или универсальный целевой домен обоих праймеров.

Поскольку наш подход заключается в работе с наборами невырожденных праймеров, в случае вырожденности прямого или обратного праймера мы заменяем вырожденный праймер на соответствующий набор невырожденных праймеров, полученных путем назначения всех возможных комбинаций значений к вырожденным нуклеотидам в праймере. Пример этой процедуры приведен в таблице 1.

Мы вычислили три балла для каждой из пар наборов праймеров и идентифицировали среди них пары наборов праймеров, образующие начальный фронт Парето.

Границы | Эффективность пар праймеров 16s рДНК в исследовании ризосферы и эндосферных бактериальных микробиомов в исследованиях метабаркодирования

Введение

Разработка и внедрение технологий секвенирования следующего поколения (NGS) и соответствующих им инструментов биоинформатики революционизировали методы изучения микробной экологии, сделав возможным профилирование сообществ с высоким разрешением (Margulies et al., 2005; Sogin et al., 2006; Parameswaran et al., 2007; Shendure, Ji, 2008; Metzker, 2010; Caporaso et al., 2011). Секвенирование ДНК генов 16S рДНК или фрагментов генов послужило стимулом для крупных исследований микробного сообщества на людях [Andersson et al., 2008; Qin et al., 2010; HMPC (Human Microbiome Project Consortium), 2012], микрофауна кишечника насекомых (Sudakaran et al., 2012; Hansen, Moran, 2014), различные естественные среды обитания (Andrew et al., 2012; DeLeon-Rodriguez et al., 2013) ; Hamdan et al., 2013), а также исследования микробиома растений (Gottel et al., 2011; Mendes et al., 2011; Bulgarelli et al., 2012; Lundberg et al., 2012; Пайффер и др., 2013; Shakya et al., 2013; Эдвардс и др., 2015). В настоящее время наиболее часто используемыми платформами секвенирования следующего поколения для профилирования микробиомов являются технология пиросеквенирования 454 (Margulies et al., 2005) и системы Illumina MiSeq и HiSeq (Caporaso et al., 2011, 2012). 454 пиросеквенирование постоянно демонстрирует свою эффективность при описании микробных сообществ, обеспечивая высоко мультиплексное секвенирование коротких гипервариабельных участков 16S рДНК (Gottel et al., 2011; Lundberg et al., 2012; Bulgarelli et al., 2013; Шакья и др., 2013). В последние годы системы Illumina HiSeq и MiSeq также заняли свое место в высокопроизводительном секвенировании 16S рДНК и даже превзошли пиросеквенирование 454 с точки зрения количества и качества считывания (Caporaso et al., 2012).

Для обеих технологий в нескольких исследованиях оценивались их технические аспекты, такие как профили ошибок (Kunin et al., 2010; Balzer et al., 2011; Gilles et al., 2011; Nakamura et al., 2011; Schirmer et al., 2015), специфические для платформы эффекты на наблюдаемые микробные сообщества (Claesson et al., 2010; Luo et al., 2012; Nelson et al., 2014; Tremblay et al., 2015), а также ошибки, вызванные специфичностью праймеров. с исследованиями in silico, (Klindworth et al., 2013) и in vivo, исследованиями (Aird et al., 2011; Berry et al., 2011; Pinto and Raskin, 2012; Kennedy et al., 2014). Другим важным аспектом микробной экологии и профилирования сообщества 16S рДНК с помощью методов NGS является наличие контаминирующих последовательностей, которые обычно совместно экстрагируются во время экстракции ДНК из различных биотических образцов.Во многих областях исследований подходы, основанные на NGS, подвержены загрязнению нежелательными последовательностями (нецелевой ДНК), например, при диагностике симптоматических инфекций (загрязнение микробной ДНК; Strong et al., 2014), при клиническом секвенировании малярии (ДНК человека) загрязнение) (Oyola et al., 2013) и анализ пищевой сети (Pompanon et al., 2012). Более конкретно, в рамках микробной экологии, при изучении межорганических ассоциаций, таких как микробиом человека [HMPC (Human Microbiome Project Consortium), 2012], ассоциации растений и микробиома (Lundberg et al., 2012; Боденхаузен и др., 2013; Bulgarelli et al., 2013; Ghyselinck et al., 2013) и исследования микробиома насекомых (Sudakaran et al., 2012; Hansen and Moran, 2014) последовательности органелларного происхождения (например, митохондрий и / или хлоропластная ДНК) представляют собой основной источник загрязнения.

Это представляет особый интерес для исследований микробиома растений, поскольку растения содержат эукариотические клетки, прокариотические клетки и органеллы эукариотических растений с прокариотическим происхождением (митохондрии и хлоропласты / пластиды) (Dyall et al., 2004; Ворон, 1970). Количество митохондрий и хлоропластов варьируется в зависимости от вида растений, типа клеток и возраста ткани, но может достигать 10 000 копий ДНК хлоропластов в клетках листьев табака (Shaver et al., 2006). Гомология между бактериальной 16S рДНК, хлоропластной ДНК и митохондриальной ДНК приводит к значительным проблемам при выборе подходящих пар праймеров для изучения взаимодействий между растениями и микробами (Ghyselinck et al., 2013). В настоящее время существуют три общих метода уменьшения воздействия этих загрязняющих последовательностей: (а) адаптация существующих протоколов экстракции ДНК для уменьшения совместной экстракции органелларной ДНК (Lutz et al., 2011) или разделение ДНК хозяина от микробной ДНК после экстракции на основе различий в плотности метилирования CpG (Feehery et al., 2013), (b) разработка блокирующих праймеров для блокирования и / или уменьшения амплификации последовательностей, происходящих из эукариотический хозяин, такой как опосредованное пептидными нуклеиновыми кислотами зажимание ПЦР (Lundberg et al., 2013) и рестрикция эндонуклеазой суицидной полимеразы (SuPER) (Green and Minz, 2005), и (c) использование специфических праймеров для несовпадения во время амплификации ПЦР (Chelius и Triplett, 2001; Sakai et al., 2004).

Предпочтительным или наиболее часто используемым методом является использование специфических праймеров для несовпадения, которые амплифицируют последовательности бактериальной 16S рДНК, одновременно избегая амплификации последовательностей ДНК хлоропластов. Chelius и Triplett (2001) разработали первый праймер для несовпадения (799F) с дизайном праймера, который сосредоточен вокруг двух несовпадений пар оснований в положениях 798–799 и двух дополнительных несовпадений пар оснований в положениях 783 и 784 в хлоропластной ДНК. Праймер 799F с переменным успехом применялся в нескольких системах растений (Bulgarelli et al., 2012; Боденхаузен и др., 2013; Shade et al., 2013). Кроме того, Sakai et al. (2004) модифицировали праймер 799F в праймер 783Rabc, пытаясь получить доступ к гипервариабельным областям V3-V4 генов бактериальной 16S рДНК при изучении ризобактериальных сообществ пшеницы и шпината. В самом деле, гипервариабельные области V3 и V4 были предпочтительной мишенью для 16S рДНК при изучении почвенных и ризосферных сообществ, и базы данных являются более исчерпывающими для этих регионов (Klindworth et al., 2013). Кроме того, Rastogi et al.(2010) использовали праймер 783Rabc для разработки основанного на ПЦР метода для определения степени загрязнения хлоропластов и митохондрий в образцах ДНК из окружающей среды растений.

Однако экспериментальные характеристики этих праймеров для несоответствия (и их потенциал снижать коамплификацию нецелевой ДНК) в различных компартментах растений с низким поступлением хлоропластов / пластид (ризосферная почва) и более высоким поступлением хлоропластов / пластид (компартменты эндосферы) имеют не оценивался. Хотя анализы in silico предоставляют ценную техническую информацию и указывают на теоретические оптимальные характеристики пар праймеров, они не отражают истинный экспериментальный потенциал и, как ожидается, приведут к неполной картине того, как праймеры будут работать во время амплификации ПЦР (Op De Beeck и другие., 2014). Следовательно, экспериментальная оценка эффективности амплификации и устойчивости выбранных пар праймеров в исследованиях взаимодействия растений и бактерий имеет важное значение для оценки их поведения в этих конкретных условиях.

По этой причине мы экспериментально протестировали набор обычно используемых праймеров для анализа бактериальных сообществ, ассоциированных с растениями, с использованием пиросеквенирования 454 (Таблица 1). Мы протестировали все выбранные пары праймеров при изучении ассоциированных с растениями бактериальных сообществ в ризосфере, корнях, стеблях и листьях гибридных деревьев тополя ( Populus tremula × P.alba ). Различное количество содержания пластидной ДНК в этих компартментах растения, от практически полного отсутствия пластид (ризосферная почва) до очень высокого содержания пластид (хлоропластов) (листья), позволяет нам оценить эффективность выбранных наборов праймеров в конкретных условиях.

Таблица 1. Сводка праймеров, использованных в текущем исследовании .

Материалы и методы

Описание места исследования и отбор проб

Полевые испытания тополя ( Populus tremula × Populus alba , cv «717-1-B4», женские клоны) в Генте, Бельгия (собственность VIB) были отобраны для получения образцов для этого исследования (Custers, 2009 ).Полевые испытания были начаты в апреле 2009 г. с плотностью 15 000 деревьев на гектар и расстоянием между растениями 0,75 м (Van Acker et al., 2014). Вкратце, образцы деревьев тополя были отобраны после ~ 3,5 лет роста в октябре 2012 г. Мы собрали образцы ризосферной почвы, корней, стеблей и листьев трех биологически независимых особей тополя. На каждую особь тополя мы собрали (а) 10 г корней на глубине 5–10 см под землей в пластиковые пробирки объемом 50 мл, (б) один полный побег для образцов стебля и листьев.Чтобы стандартизировать и максимизировать воспроизводимость образцов стеблей, с каждого ответвления было собрано несколько небольших «стержней» с корой (5–7 стержней, каждое около 1 см). Наконец, все листья каждого побега были собраны и помещены в герметичные пластиковые пакеты для транспортировки.

Обработка образцов

Образцы корней тополя встряхивали в течение 10 мин на встряхивающей платформе (100 об / мин) и собирали частицы почвы, смещенные с корней, как ризосферную почву. Почву ризосферы просеивали через сито 2 мм для гомогенизации и удаления остатков корней и мусора.Впоследствии образцы хранили при -80 ° C до экстракции ДНК.

Эпифиты (микробы, живущие на поверхности растений) были удалены из всех образцов растений (корни, стебли и листья) путем поверхностной стерилизации в асептических условиях. Образцы последовательно промывали (а) стерильной водой Millipore (30 с), (б) с последующим погружением в 70% (об. / Об.) Этанолом (2 мин), (в) раствором гипохлорита натрия (2,5% активного Cl ). , 5 мин) с добавлением 0,1% Tween 80, (d) 70% (об. / Об.) Этанола (30 с) и завершили промыванием образцов пять раз стерильной водой Millipore.Наконец, образцы растений (~ 5 г каждого отделения на образец) гомогенизировали путем (а) разделения образцов на небольшие фрагменты с помощью стерильного скальпеля и (б) мацерации их в стерильном 10 мМ фосфатном солевом (PBS) буфере (130 мМ NaCl, 7 мМ Na 2 HPO 4 , 3 мМ NaH 2 PO 4 , pH 7,4) с использованием смесителя Polytron PR1200 (Kinematica A6) за четыре цикла по 2 мин с охлаждением смесителя на льду между циклами до уменьшить нагрев образцов. Наконец, четыре экземпляра аликвот каждого образца (1.5 мл гомогенизированного растительного материала (корень, стебель и лист) хранили для всех особей тополя при -80 ° C до экстракции ДНК.

Экстракция ДНК

ДНК

из ризосферы, корней, стеблей и листьев (далее обозначаемых как «компартменты растений») экстрагировали в четырех повторностях из трех биологически независимых особей тополя, чтобы минимизировать систематическую ошибку экстракции ДНК (Feinstein et al., 2009; Op De Beeck et al., 2014). Всего ДНК была извлечена из 48 образцов (3 особи тополя × 4 отделения растений × 4 экстракции в четырех экземплярах на образец).

Приблизительно 250 мг ризосферной почвы использовали для каждой отдельной экстракции ДНК. Экстракцию ДНК проводили с помощью набора Power Soil DNA Isolation Kit в соответствии с протоколом, предоставленным производителем (MoBio, Карлсбад, Калифорния, США). Для частей растений (корни, стебли, листья) аликвоты (1,5 мл) гомогенизированного растительного материала сначала центрифугировали (13,400 об / мин, 30 мин) для сбора всех клеток. Супернатанты отбрасывали и проводили экстракцию ДНК на осажденном растительном материале.После оптимизации набора для экстракции ДНК (рис. S1) ДНК экстрагировали из образцов растений с помощью набора Invisorb Spin Plant Mini Kit в соответствии с протоколом производителя (Stratec Biomedical AG, Биркенфельд, Германия).

In Silico Оценка пар праймеров

Чтобы выбрать подходящие пары праймеров из всех доступных праймеров 16S рДНК, несколько параметров (Таблица 1):

(A) Покрытие праймеров и спектр типов всех праймеров 16S рДНК были запрошены с использованием данных Silva (Klindworth et al., 2013; Quast et al., 2013) и probeBase (Loy et al., 2007).

(B) Чтобы оценить 3′-несовпадения праймеров-мишеней, праймеры были протестированы с помощью PrimerProspector 1.0.1 (Walters et al., 2011) по базе данных Greengenes (gg_13_5.fasta), содержащей 1262 986 последовательностей (DeSantis et al., 2006 г.). Эта база данных была обработана с использованием mothur (версия 1.34.3) для удаления последовательностей, содержащих неоднозначные основания, и последовательностей с гомополимерами длиной более восьми оснований. Кураторская база данных содержала 946 815 последовательностей 16S рДНК со средней длиной чтения 1399.4 пары оснований. Все тесты праймеров проводили, как описано Walters et al. (2011) с использованием стандартных настроек. Оценки праймеров рассчитывались по следующей формуле: взвешенная оценка = несовпадения, не являющиеся 3 ′ × 0,40 + 3 ′ несоответствия × 1,00 + пробелы, не являющиеся 3 ′ × 1,00 + 3 ′ промежутки × 3,00. Дополнительный штрафной балл 3,00 присваивался, если последнее 3′-основание праймера не соответствовало его целевой последовательности.

(C) Наличие несовпадений с ДНК хлоропластов тополя оценивали путем загрузки полного генома хлоропластов Populus alba из NCBI и обработки каждого праймера с помощью быстрой ПЦР (Kalendar et al., 2014).

(D) Общий охват наиболее часто используемых гипервариабельных участков оперона 16S рРНК и полученная длина ампликона.

ПЦР-амплификация и 454 пиросеквенирование

Для ПЦР-амплификации мы выбрали семь различных пар праймеров, чтобы оценить их эффективность в исследованиях метабаркодирования ризосферных и эндофитных бактерий (таблица 1). Пары праймеров покрывали все гипервариабельные области от V1 до V7 гена 16S рДНК и включали, среди прочего, праймер 799F (5′-AACMGGATTAGATACCCKG-3 ‘) (Chelius and Triplett, 2001) и праймер 783Rabc (5’-CTACC * AGGGTATCTAATCC * TG; Sakai et al., 2004), которые теоретически минимизируют загрязнение хлоропластов, обеспечивая значительные несовпадения с ДНК пластид тополя (3–4 несовпадения). Все праймеры и их последовательности перечислены в таблице 1. За исключением пары праймеров 68F-518R, все прямые праймеры были слиты с адаптером пиросеквенирования Roche 454 A и специфичным для образца штрих-кодом 10 п.н. соединен с адаптером B (Roche Applied Science, Мангейм, Германия). Для пары праймеров 68F-518R обратный праймер слили с адаптером A, а прямой праймер слили с адаптером B.

образцов ДНК ( n = 48) были индивидуально амплифицированы с использованием термоциклера Techne TC-5000 (Bibby Scientific Limited, Стаффордшир, Великобритания) с семью различными парами праймеров. Поскольку концентрация бактериальной ДНК по сравнению с ДНК растений низкая, мы выбрали стратегию вложенной ПЦР, чтобы амплифицировать все образцы и тем самым минимизировать образование димеров праймеров. Первый раунд ПЦР-амплификации был проведен с использованием праймеров без адаптеров для пиросеквенирования Roche 454 и штрих-кода, специфичного для образца.Каждая реакция ПЦР на 25 мкл содержала ~ 10 нг ДНК и проводилась с использованием системы FastStart High Fidelity PCR System (Roche Applied Science, Мангейм, Германия). Каждая реакция содержала 2,75 мкл 10-кратного реакционного буфера FastStart, 1,8 мМ MgCl 2 , 0,2 мМ смесь dNTP, 0,4 мкМ каждого праймера и 2 единицы полимеразы FastStart HiFi. Условия цикла включали: начальную денатурацию при 94 ° C в течение 3 минут, затем 35 циклов денатурации при 94 ° C в течение 1 минуты, отжиг при 53 ° C в течение 1 минуты и удлинение при 72 ° C в течение 1 минуты; заключительную фазу удлинения проводили при 72 ° C в течение 10 мин.Пулы ампликонов ПЦР очищали от остаточных праймеров и димеров праймеров путем разделения продуктов ПЦР на 1,5% агарозном геле. Бактериальные ампликоны вырезали из гелей с помощью набора для экстракции гелей QIAQuick (Qiagen Benelux N.V., Венло, Нидерланды). Митохондриальные продукты, продуцируемые праймерами 799F-1391R и 799F-1193R длиной соответственно 1000 и 800 п.н., также были удалены с помощью очистки в геле (рис. S2). После первого раунда ПЦР-амплификации и гель-очистки продуктов ПЦР был проведен второй раунд ПЦР-амплификации для всех семи пар праймеров с адаптерами пиросеквенирования Roche 454 и штрих-кодами, специфичными для образцов.Длина ампликона последовательностей, продуцируемых парами праймеров 799F-1391R и 68F-783Rabc, была уменьшена путем амплификации образцов с 967F-1391R и 68F-518R во втором раунде. Условия цикла ПЦР были идентичны описанным ранее, за исключением количества циклов ПЦР, которое было снижено до 25.

Впоследствии четырехповторные пулы ампликонов для ПЦР из соответствующих образцов были объединены вместе, чтобы в итоге получить 12 образцов из четырех различных компартментов (ризосфера, корень, стебель, лист) трех биологически независимых особей тополя.Пулы ампликонов ПЦР очищали для удаления остаточных праймеров ПЦР и димеров праймеров с использованием набора для очистки ПЦР QIAquick (Qiagen Benelux B.V., Венло, Нидерланды). После очистки качество пулов ампликонов оценивали с помощью системы Agilent 2100 Bioanalyzer (Agilent Technologies, Diegem, Бельгия) в соответствии с протоколом производителя. Наконец, библиотеки очищенных ампликонов были количественно определены с помощью набора для анализа дцДНК Quant-iT PicoGreen (Invitrogen, Карлсбад, Калифорния, США) и планшет-ридера Fluostar Omega (BMG Labtech, Ортенберг, Германия) и объединены в эквимолярных концентрациях.Полученные семь пулов ампликонов (по одному на каждую пару праймеров), каждый из которых содержит 12 образцов, секвенировали на одной восьмой части планшета Pico Titer на геномном секвенаторе Roche FLX + с использованием химии титана (Roche Applied Science, Мангейм, Германия) от LGC. Геномика (Берлин, Германия). Общий пул ампликонов состоял из 26 образцов, в том числе 14 образцов, относящихся к другому исследованию.

Обработка последовательности

В результате секвенирования

было создано семь отдельных файлов в стандартном формате блок-схемы (SFF), которые были проанализированы отдельно с помощью программного пакета mothur (версия 1.34.3) в соответствии со Стандартной операционной процедурой, изложенной в http://www.mothur.org/wiki/Schloss_SOP (Schloss et al., 2009). Вкратце, ошибки секвенирования были уменьшены за счет шумоподавления (shhh.flows, mothur реализация алгоритма Amplicon Noise) и качественной обрезки, при которой удалялись считывания короче 200 оснований, считывания с гомополимерами длиной более восьми оснований и считывания, содержащие неоднозначные основания. Уникальные последовательности были идентифицированы при архивировании данных о численности уникальных последовательностей и выровнены с использованием выравнивания.seqs с эталонным выравниванием SILVA (версия 119) (Pruesse et al., 2007). Внутри уникальных последовательностей химерные последовательности были идентифицированы с помощью инструмента Uchime (обнаружение химер de novo ) (Edgar et al., 2011) с последующим их удалением из набора данных. Таксономическая классификация последовательностей была проведена с отсечением 80%. Последовательности, соответствующие «хлоропласту» и «митохондриям», были идентифицированы с использованием classify.seqs, и данные о численности этих последовательностей были использованы для сравнения эффективности всех пар праймеров (таблица 2).Впоследствии эти последовательности были удалены из набора данных. Наконец, OTU на уровне рода (операционная таксономическая единица) были определены на основе 97% уровня сходства последовательностей. Полная параметрическая оценка была проведена с парами праймеров 799F-1391R, 799F-1193R и 341F-783Rabc на основе низкой коамплификации нецелевой ДНК и высокой степени извлечения бактериальных считываний. Поскольку эти выбранные пары праймеров приводили к разному количеству считываний на образец, количество считываний на образец было уменьшено до 417 считываний на образец.Образцы, для которых было получено менее 417 считываний, были удалены из набора данных. Только для пары праймеров 341F-783Rabc мы удалили 3 образца, все из которых принадлежали стволу. Кривые разрежения были собраны на основе 10 000 перестановок и оценок внутривыборочного богатства, разнообразия и охвата Гуда, которые были рассчитаны в mothur (версия 1.34.3) на основе 10 000 итераций.

Таблица 2. Показатели качества анализа пиросеквенирования, коамплификации нецелевой ДНК и амплификации бактериальной рДНК показывают .

Файлы стандартного формата блок-схемы (SFF) были депонированы в архиве считывания последовательностей NCBI (SRA) под номером биопроекта PRJNA318176 и номерами доступа в BioSample SAMN04633889 на SAMN04633970.

Выделение интактных хлоропластов для извлечения чистой ДНК хлоропласта

Интактные хлоропласты выделяли из листьев ( Populus tremula × P. alba ) по методу, описанному Cortleven et al. (2011). Вкратце, свежие листья (~ 10 г) собирали и гомогенизировали в 100 мл ледяного буфера для измельчения (2.0 мМ NaEDTA; 1,0 мМ MgCl 2 ; 1,0 мМ MnCl 2 ; 50,0 мМ Hepes / KOH, pH 7,5; 0,33 М сорбитол; 5,0 мМ аскорбата натрия) с использованием смесителя Braun MX-32. Полученный гомогенат фильтровали через четыре слоя Miracloth (размер пор: 22-25 мкм) и центрифугировали (1400 g, 5 мин). Осадок ресуспендировали в 1 мл буфера для измельчения, после чего суспензию загружали в непрерывный градиент 10-80% Перколла (3% PEG 6000; 1% Ficoll; 1% BSA) и центрифугировали (8000 g, 20 мин). Наконец, интактные хлоропласты собирали после центрифугирования (нижняя полоса), дважды промывали пятью объемами буфера для измельчения и хранили при -70 ° C до экстракции ДНК хлоропластов.ДНК экстрагировали из интактных хлоропластов с помощью набора Invisorb Spin Plant Mini Kit, следуя инструкциям производителя.

Количественная ПЦР в реальном времени

Для оценки эффективности праймеров выбранных пар праймеров, амплифицирующих чистую ДНК хлоропластов ( Populus tremula × P. alba ), мы протестировали все пары праймеров в установке кПЦР. Из пяти образцов ДНК хлоропластов мы сделали серию двукратных разведений (от 1: 2 до 1:64). Условия цикла кПЦР включали: начальную денатурацию при 94 ° C в течение 3 минут, затем 35 циклов денатурации при 94 ° C в течение 1 минуты, отжиг при 53 ° C в течение 1 минуты и удлинение при 72 ° C в течение 1 минуты; заключительную фазу удлинения проводили при 72 ° C в течение 10 мин.Наконец, была построена кривая диссоциации для проверки эффективности амплификации. Каждая реакция содержала 2 мкл матричной ДНК, 5 мкл 2 x Fast SYBR Green Master Mix (Applied Biosystems, Фостер-Сити, Калифорния, США), 0,3 мкл прямого и обратного праймера (по 0,3 мкМ каждый) и 2,4 мкл воды, свободной от нуклеаз, в общий объем 10 мкл. Эффективность ПЦР ( E ) рассчитывалась как E = (10 −1 ∕ наклон −1) × 100.

Статистический анализ

Статистический анализ был выполнен в R 2.15.1 (Фонд R для статистических вычислений, Вена, Австрия). Нормальное распределение данных проверялось с помощью теста Шапиро – Уилка, а гомоскедастичность дисперсий анализировалась с помощью теста Бартлетта или Флигнера – Киллинса. Значительные различия в дисперсии параметров оценивали в зависимости от распределения оцениваемых параметров либо с помощью дисперсионного анализа, либо с помощью критерия суммы рангов Краскела-Уоллиса. Апостериорные сравнения проводились либо с помощью тестов честных значимых различий Тьюки, либо с помощью тестов парной суммы рангов Уилкоксона.Для данных о численности использовались поправки Пуассона, а распределения соотношений сравнивались с критериями хи-квадрат Пирсона. Статистический анализ многомерных данных проводился в соответствии с рекомендациями Андерсона и Уиллиса (2003). Неметрическое многомерное масштабирование (NMDS) было выполнено с использованием пакета Vegan 2.0–8 в R (Oksanen et al., 2013) с 10 000 итераций. Данные обилия OTU были преобразованы с использованием метода квадратного корня (для уменьшения веса количественно обильных OTU), а сходства в структурах бактериального сообщества были отображены с неметрическим многомерным масштабированием (NMDS) с расстояниями Брея-Кертиса (Bray and Curtis, 1957).Различия между априори определенными группами оценивали с помощью тестов гипотез на основе перестановок, а именно анализа сходства (ANOSIM), аналога одномерного дисперсионного анализа. Оценки богатства сообщества (количество OTU, оценка Chao1, оценка ACE и Bootstrap) и оценки разнообразия сообществ (индексы Бергера-Паркера, Шеннона, непараметрические индексы Шеннона, QStat, Simpson и Inverse Simpson) были рассчитаны в Mothur с использованием 10 000 итераций.

Результаты и обсуждение

После анализа in silico в наш окончательный выбор были включены праймеры 799F и 783Rabc (Chelius and Triplett, 2001; Sakai et al., 2004), содержащий несколько несовпадений с ДНК хлоропласта. На основании 3′-несовпадений праймер-мишень, общего покрытия и с учетом длины ампликона, оба праймера были сопоставлены с двумя праймерами для получения четырех пар праймеров, соответственно 799F-1391R, 799F-1193R, 341F-783Rabc и 68F-783Rabc. . Кроме того, мы включили пару праймеров 341F-785R, как описано Klindworth et al. (2013), чтобы оценить эффективность наборов праймеров для несоответствия с идеальной парой праймеров для исследований метабаркодирования 16S рДНК с 454 приложениями Последовательности праймеров и полные результаты анализа in silico показаны в Таблице 1 и Таблице S1.

454 Пиросеквенирование

Мы проанализировали 12 образцов, полученных из четырех различных компартментов растений (ризосфера, корни, стебли и листья) тополя ( Populus tremula × P. alba ) с семью выбранными парами праймеров бактериальной 16S рДНК (Таблица 1). Секвенирование библиотек ампликонов дало в общей сложности 799 429 прочтений со средним значением (± стандартное отклонение) 114 204 (± 12013) прочтений. Показатели качества показаны в таблице 2 с общим количеством считываний, полученных для каждого отделения растения, и средней длиной считывания до и после проверки качества и обрезки (таблица 2А).

Коамплификация нецелевой ДНК

Во-первых, мы оценили коамплификацию нецелевой ДНК, например, хлоропластной и митохондриальной ДНК, всеми парами праймеров в различных компартментах растения после нормализации до 1000 считываний (таблица 2B, C). В ризосфере некоторые из выбранных пар праймеров извлекали мельчайшие фракции хлоропластов (967F-1391R: <0,1%, 341F-785R: 0,1%, 341F-783Rabc: <0,1%) и митохондрий (799F-1193R; <0,1%). последовательности. Извлечение пластидной и митохондриальной ДНК из образцов почвы ризосферы, скорее всего, связано со следами разлагающихся тканей корня, стебля или листа, а также с присутствием в почве эукариотических организмов (митохондриальных последовательностей).Кроме того, почва ризосферы неизбежно загрязнена живыми и мертвыми пограничными клетками корневого чехлика, которые, как было показано, остаются живыми после слущивания корня корня (Vermeer and McCully, 1982; Hawes et al., 2000; Bulgarelli et al., 2013).

В компартментах растений мы обнаружили значительные различия в производительности пар праймеров для совместной амплификации нецелевой ДНК (таблица 2B, C). Как и ожидалось, интерференция нецелевой ДНК была значительно снижена парами праймеров, содержащими прямой или обратный праймер с включенными несовпадениями с хлоропластной ДНК, например.g., праймеры 799F и 783Rabc (только в комбинации с 341F). Пары праймеров 799F-1391R и 799F-1193R полностью устраняли коамплификацию последовательностей пластидной ДНК в образцах корня и последовательностей пластид / хлоропластов в образцах стебля и листа. Действительно, праймер 799F и его варианты использовались для минимизации загрязнения хлоропластов в образцах растений с переменным успехом и в большинстве случаев приводили к некоторой коамплификации ДНК хлоропластов (Sun et al., 2008; Sagaram et al., 2009; Redford et al., 2010; Триведи и др., 2010; Брагина и др., 2012; Bulgarelli et al., 2012; Боденхаузен и др., 2013; Santhanam et al., 2014; Schlaeppi et al., 2014). Однако, хотя праймер 783Rabc (Sakai et al., 2004) показал 3 несоответствия с ДНК тополя во время анализа in silico (Таблица 1), в экспериментальной установке он не смог эффективно устранить амплификацию ДНК хлоропластов (Таблица 2). Комбинация пар праймеров 341F-783Rabc достаточно хорошо проявила себя в образцах корней (26% пластидной ДНК), но более высокое содержание хлоропластов в образцах стеблей и листьев привело к значительной коамплификации хлоропластной ДНК (80% в стеблях и 52% в листьях). ) (Таблица 2).Хотя пара праймеров 341F-783Rabc показала лучшие результаты, чем другие пары праймеров (без несоответствий хлоропластов) (таблица 2), в снижении коамплификации ДНК хлоропластов, анализ in silico показал неверное изображение потенциала праймера и подтвердил, что положение несовпадений имеют решающее значение для их эффективности в ПЦР-амплификации (Ayyadevara et al., 2000; Klindworth et al., 2013; Lefever et al., 2013). Полные подсчеты последовательностей хлоропластов и митохондрий и статистические различия представлены в Таблице 2B, C.

Интересно, что мы последовательно извлекали больше последовательностей хлоропластов из образцов стебля по сравнению с образцами листьев для всех пар праймеров (кроме 799F-1193R), хотя и не статистически значимо для всех пар праймеров. Хотя абсолютная концентрация ДНК хлоропластов явно выше в образцах листьев (являющихся основным фотосинтетическим органом), чем в образцах ствола, баланс между ДНК эндофитных бактерий и ДНК хлоропластов, по-видимому, является более важным фактором в коамплификации ДНК хлоропластов.Стебли тополя сильно одревесневшие и состоят из большого количества мертвых клеток (сосудов ксилемы) (Boerjan et al., 2003; Vanholme et al., 2010) с низким содержанием питательных веществ (Siebrecht et al., 2003; Danielsen et al., 2013; Morhart et al., 2013) и, следовательно, скорее всего, содержат меньше общих бактериальных клеток, чем образцы листьев, тем самым смещая баланс в сторону ДНК хлоропластов.

Наконец, мы также подсчитали количество бактериальных последовательностей рДНК 16S для каждой пары праймеров в каждом компартменте растения (таблица 2D).Эти числа последовательностей, конечно, коррелируют с числами последовательностей извлеченной нецелевой ДНК из органеллярного источника.

Эффективность праймера для чистой ДНК хлоропласта (тополь)

Чтобы оценить, коррелируют ли наблюдаемые различия в амплификации последовательностей хлоропластов в экстрактах ДНК растений-бактерий во время метабаркодирования 16S рДНК с эффективностью ПЦР-амплификации выбранных пар праймеров для чистой ДНК хлоропластов, был проведен эксперимент кПЦР.С этой целью мы выделили чистую ДНК хлоропластов из интактных хлоропластов (Cortleven et al., 2011) 5 образцов листьев тополя и амплифицировали чистую ДНК хлоропластов с выбранными парами праймеров (рис. 1). Мы наблюдали сильную корреляцию между установкой кПЦР и результатами пиросеквенирования. Пары праймеров 799F-1391R и 799F-1193R показали очень низкое сродство к чистой ДНК хлоропластов тополя (эффективность соответственно 9,2 и 17,4%), что привело к практически отсутствию амплификации ДНК хлоропластов в установке пиросеквенирования.Среднее сродство к ДНК хлоропласта 16S наблюдали для пар праймеров 68F-783Rabc (67,3%) и 341F-783Rabc (50,3%), что приводило к дифференциальной амплификации ДНК хлоропласта (особенно для 341F-783Rabc) в зависимости от содержания пластида / хлоропласта (корень vs стебель и лист) в установке пиросеквенирования. Другие пары праймеров 967F-1391 (94,5%), 341F-785R (91,1%) и 68F-518R (95,3%) показали очень высокую эффективность ПЦР-амплификации и действительно привели к высокой коамплификации ДНК хлоропластов во время метабаркодирования (Таблица 2B, C).

Рис. 1. Средняя эффективность ПЦР-амплификации выбранных праймеров 16S рДНК для чистой ДНК хлоропластов (тополь) с использованием количественной ПЦР в реальном времени . Значения представляют собой средние значения пяти биологически независимых повторов ± стандартная ошибка. Эффективность ПЦР сравнивали с использованием однофакторного дисперсионного анализа. Различия на уровне значимости 95% обозначены строчными буквами ( P <0,05).

Параметрическое сравнение выбранных пар праймеров

На основании низких уровней коамплификации последовательностей хлоропластов и митохондрий и, следовательно, высокой степени извлечения считываний бактериальной рДНК (Таблица 2D), мы выбрали пары праймеров 799F-1391R, 799F-1193R и 341F-783Rabc для дальнейшего параметрического анализа (Рисунки 2, 3).

Рис. 2. Оценки покрытия Гуда и кривые разрежения различных репликатов из каждого компартмента растения (ризосферная почва, корень, стебель и лист) для каждой пары праймеров, включая (A) 799F-1391R, (B) 799F-1193R и (К) 341F-783Rabc . Оценка покрытия Good была рассчитана в mothur на основе 10 000 итераций. Различия на уровне значимости 95% между компартментами растений обозначены строчными буквами ( P <0,05). Были построены кривые разрежения, показывающие количество наблюдаемых OTU, определенных при 97% отсечении сходства последовательностей, по отношению к общему количеству идентифицированных последовательностей бактериальной рДНК.Для расчета оценок сообщества выборка была увеличена до 417 прочтений. NA = Недоступно из-за низкого уровня извлечения считываний бактериальной рДНК.

Рис. 3. Сравнение параметрического альфа-разнообразия между выбранными парами праймеров 16S рДНК (799F-1391R, 799F-1193R и 341F-783Rabc) для всех отобранных компартментов растений [(A) ризосферная почва, (B) корень, (C) Стебель, (D) Лист] после подвыборки до 417 читается . Все средние значения были рассчитаны по трем биологически независимым особям тополя для каждой пары праймеров.Левые панели: среднее количество операционных таксономических единиц (OTU), наблюдаемое на основе 97% -ного ограничения сходства последовательностей (богатство), и правые панели: обратные индексы разнообразия Симпсона. Подсчет OTU и индексы обратного Симпсона были статистически проанализированы с использованием однофакторного дисперсионного анализа для каждой части растения. Различия на уровне значимости 95% обозначены строчными буквами ( P <0,05). nd = не определено в результате низкого считывания бактериальной рДНК.

Кривые разрежения и оценки охвата Гудом показали, что наши усилия по отбору образцов (независимо от пары праймеров) для ризосферных образцов были недостаточными (от 50 до 50.От 1 до 63,7%), чтобы полностью захватить бактериальные сообщества (рис. 2). Действительно, кривые разрежения из других исследований с использованием образцов ризосферной почвы имеют тенденцию к насыщению только после 5000–6000 секвенированных считываний (Gottel et al., 2011). Наблюдаемые низкие оценки охвата Гудом были частично результатом нашего низкого уровня подвыборки (417 последовательностей), используемого для включения как можно большего количества образцов в параметрическое сравнение пар праймеров. Более высокие уровни подвыборки (1500 последовательностей) показали значительно более высокие оценки покрытия Гуда в образцах ризосферной почвы для всех пар праймеров (от 76 до 91%; данные не показаны).Однако сравнение выбранных пар праймеров выявило наибольшее богатство OTU для пар праймеров 799F-1391R и 341F-783Rabc, которые давали в среднем одинаковое количество OTU ( P = 0,80) с 277 OTU (мин = 271; макс. = 281) и 270 OTU (мин. = 265; макс. = 276) на выборку соответственно. Для пары праймеров 799F-1193R богатство OTU было значительно ниже ( P <0,01), в среднем 236 OTU (min = 227; max = 252) на образец (рис. 3A). Оценки разнообразия, полученные методом обратного Симпсона, были сопоставимы для всех праймеров (рис. 3А).

Для образцов корня, стебля и листа кривые разрежения всех пар праймеров имели тенденцию к насыщению, демонстрируя, что усилия по секвенированию были достаточными для получения наиболее распространенных бактериальных OTU. Оценки охвата Good варьировались от 83,6% до 97% (рис. 2). В корнях сравнение выбранных пар праймеров снова выявило наивысшее богатство OTU для пары праймеров 799F-1391R, которая дает в среднем 115 OTU (мин. = 93; макс = 143) на образец. Это по сравнению с набором праймеров 799F-1193R, который извлек 79 OTU (min = 58; max = 111) на образец, и парой праймеров 341F-783Rabc, которая дала 87 OTU (min = 62; max = 117) (рис. 3B).Gottel et al. (2011) сообщили о высокой вариабельности извлечения ОТЕ, выделенных из корней тополей в зрелых естественных экосистемах (83 ОТЕ на образец ± 78). Однако важно отметить, что мы сузили наши выборки до 417 последовательностей на выборку, тем самым уменьшив количество извлекаемых OTU. Действительно, гораздо более высокие показатели богатства ОТЕ наблюдались в корнях и листьях Arabidopsis thaliana (Bulgarelli et al., 2012; Lundberg et al., 2012; Bodenhausen et al., 2013). Обратные оценки разнообразия Симпсона продемонстрировали четкую тенденцию к более высоким оценкам разнообразия в праймере 799F-1391R по сравнению с парами праймеров 799F-1193R и 341F-783Rabc, хотя и не статистически значимыми для образцов почвы и корней ризосферы (рис. 3B).

Наконец, в стебле и листьях (Фигуры 3C, D) мы постоянно наблюдали наибольшее богатство OTU для пары праймеров 799F-1391R ( P <0,01). В стволе (рис. 3C) пара праймеров 799F-1391R извлекала в среднем 109 OTU (мин. = 107; макс. = 110). Напротив, набор праймеров 799F-1193R получил только 47 OTU (мин. = 45; макс. = 51) на образец в стеблях. Для пары праймеров 341F-783Rabc, богатство OTU не может быть определено в образцах ствола (nd) из-за очень низкой амплификации считываний бактериальной рДНК (таблица 2 и рисунок 3C).В листьях (фигура 3D) пара праймеров 799F-1391R давала в среднем 90 OTU (мин. = 80; макс. = 102), тогда как наборы праймеров 799F-1193R и 341F-783Rabc извлекали значительно меньше ( P <0,01) OTU с соответственно , 29 OTU (min = 22; max = 39) и 28 OTU (min = 23; max = 33) на выборку. Для обратного индекса Симпсона в стеблях и листьях пара праймеров 799F-1391R постоянно показывала более высокое разнообразие по сравнению с парами праймеров 799F-1193R и 341F-783Rabc ( P <0,01).Индексы разнообразия не могли быть рассчитаны для пары праймеров 341F-783Rabc в образцах ствола из-за низкой амплификации бактериальных считываний.

Чтобы исключить систематическую ошибку в оценках богатства и разнообразия сообществ, мы включили несколько других альтернативных оценок (таблица S2). Большинство оценщиков подкрепляют результаты, полученные на основе количества наблюдаемых OTU и обратного индекса Симпсона на рисунке 3, и приводят к аналогичным тенденциям, хотя не все они статистически значимы.

Общинное сходство между парами грунтовок и отделениями растений

Для сравнения бактериальных сообществ, полученных с помощью каждой выбранной пары праймеров (799F-1391R, 799F-1193R и 341F-783Rabc) на уровне типа и рода, относительные частотные распределения полученных OTU и типов на уровне рода были проанализированы с помощью chi- квадратичные тесты для трех пар праймеров, основанные на средней численности в повторяющихся образцах.На уровне типа и рода наблюдались различия ( P <0,05) для всех трех пар праймеров во всех компартментах растения. Кроме того, мы сравнили численность OTU на уровне типа и рода в образцах для каждой пары праймеров в каждом компартменте растения, используя неметрическое многомерное масштабирование (NMDS) с различиями Брея-Кертиса (Рисунок S3). Наблюдаемые различия в выделении OTU в соответствии с выбранной парой праймеров на уровне филума (рисунок S3a, ANOSIM: P <0.05) и на уровне рода (рисунок S3b, ANOSIM: P <0,05) демонстрируют, что основной выбор праймера смещения может вносить в исследованиях метабаркодирования (Aird et al., 2011; Berry et al., 2011; Pinto and Raskin, 2012; Ghyselinck et al., 2013; Klindworth et al., 2013; Op De Beeck et al., 2014; Tremblay et al., 2015).

Наконец, мы сравнили бактериальные сообщества (NMDS), полученные для каждого компартмента растения в каждой паре праймеров (рис. S4). В целом, независимо от пары праймеров, существенно разные OTU (ANOSIM: P <0.05) были обнаружены в каждом компартменте растения на уровне типа (рис. S4a) и уровне рода (рис. S4b), что четко иллюстрирует дифференциацию специфических ниш ассоциированных с растением бактерий. Для пары праймеров 341F-783R наблюдалась более низкая внутривариабельность образцов (в основном на уровне филума), что приводило к немного более низким значениям стресса (и немного более высоким уровням значимости) соответствия NMDS по сравнению с другими парами праймеров. Однако пара праймеров 341F-783R также показала значительно более низкие оценки индекса богатства OTU и разнообразия (фиг. 3), что указывает на то, что более низкая внутривариабельность образцов вызвана низким (и менее разнообразным) извлечением OTU.

Мы ранее наблюдали такую ​​же дифференциацию ниш при изоляции культивируемых бактерий с деревьев тополя в том же полевом исследовании (Beckers et al., 2016). Дифференциация ниши между ризосферой и микробиомом корневых эндофитов была описана для взрослых деревьев тополя, произрастающих в естественных экосистемах ( Populus deltoides ) (Gottel et al., 2011; Shakya et al., 2013), для Arabidopsis thaliana экотипов (Bulgarelli et al., 2012; Lundberg et al., 2012; Schlaeppi et al., 2014; Bai et al., 2015) и других видов растений (Inceoğlu et al., 2010; Weinert et al., 2011; Ofek-Lalzar et al., 2014; Edwards et al., 2015). Недавно Bulgarelli et al. (2013) предложили двухэтапную модель отбора для дифференциации корневой микробиоты от ризосферы, где ризодепозиция и тонкая настройка, зависящая от генотипа хозяина, сходятся, чтобы выбрать специфические эндофитные сообщества. Хотя мы использовали ограниченное количество биологических реплик (3), наши данные указывают на дополнительную тонкую настройку и дифференциацию ниш микробиоты в надземных органах растений, при этом бактериальные сообщества стебля и листа заметно отличаются от корня и ризосферы (Рисунок S4 ).Это несколько контрастирует с выводами Bai et al. (2015), которые сообщили о значительном совпадении таксономии и кодируемых геномом функциональных компетенций между листовой и корневой микробиотой Arabidopsis thaliana . Хотя некоторые из их доказательств из экспериментов по реколонизации также указывали на видоизменение среды обитания микробиома к их соответствующей экологической нише (Bai et al., 2015).

основных членов микробиома, идентифицируемых каждой парой праймеров

Наконец, мы также получили первое представление о ризосферных и эндофитных бактериальных сообществах, связанных с различными растениями на деревьях тополя ( Populus tremula × P.alba ) в полевом испытании под следствием.

Примечательно, что мы обнаружили явную разницу в количестве прочтений, которые нельзя однозначно классифицировать на уровне типа в области V6-V7 (799F-1391R: 46% ± 0,5, 799F-1193R: 49% ± 2,6) по сравнению с в область V3-V4 (341F-783Rabc: 21% ± 0,5) ( P <0,05) в образцах ризосферы. Это свидетельствует о недостаточном представлении в базе данных биоразнообразия почвенных бактерий и недостаточной представленности гипервариабельной области V6-V7 (Gans et al., 2005; Bulgarelli et al., 2012). Действительно, V3-V4 был предпочтительным регионом для исследований следующего поколения (Klindworth et al., 2013). Поэтому, по крайней мере, в настоящее время, для изучения бактерий, ассоциированных с растениями, приходится выбирать для V6-V7 компромисс с доступностью праймеров, чтобы избежать коамплификации органеллярной ДНК, но с недостаточным представлением последовательностей. в этом регионе в базах данных.

На уровне филума (рис. 4) большинство ОТЕ в ризосферной почве (рис. 4А), идентифицированных всеми парами праймеров, были отнесены к Proteobacteria (от 37 до 60%), актинобактериям (от 14 до 25%), ацидобактериям (3 до 21%) и Bacteriodetes (от 3 до 9%).В корнях (рис. 4B) для всех пар праймеров мы наблюдали сильное преобладание Proteobacteria (от 78 до 91%) с меньшим количеством идентифицированных OTU, принадлежащих Bacteriodetes (от 2 до 11%), Actinobacteria (от 2 до 4%). , и TM7 (от 1 до 4%). В стеблях (рис. 4C) преобладание типа Proteobacteria (от 48 до 97%) сохранялось, хотя оно было немного менее выражено при анализе пар праймеров 799F-1391R (61%) и 799F-1193R (48%) по сравнению с праймером. пара 341F-783Rabc (97%). Скорее всего, это наблюдение напрямую связано с очень уменьшенным количеством бактериальных последовательностей, полученных из образцов ствола с помощью пары праймеров 341F-783Rabc.Для анализов, основанных на парах праймеров 799F-1391R и 799F-1193R, остальные идентифицированные OTU в основном принадлежали Actinobacteria (соответственно 11 и 19%) и Deinococcus-Thermus (соответственно 6 и 27%). Наконец, в листьях большинство OTU также были идентифицированы как Proteobacteria (82–96%). Меньшая часть ОТЕ, обнаруженных в листьях, принадлежала к линиям актинобактерий (от 3 до 11%) (рис. 4D).

Рис. 4. Относительная численность последовательностей бактериальных типов, связанных с различными компартментами растений [(A) ризосферная почва, (B) корень, (C) стебель, (D) лист], идентифицированная тремя выбранными парами праймеров (799F-1391R, 799F-1193R и 341F-783Rabc) .Протеобактерии OTU были заменены 4 OTU на уровне подкласса (альфа, бета, гамма, дельта). Реплики отображаются в отдельных столбцах, а также усредняются по паре праймеров.

При более внимательном рассмотрении уровня филума в ризосфере мы преимущественно идентифицировали Proteobacteria, Acidobacteria и Actinobacteria , независимо от выбранной пары праймеров. Ранее было показано, что соотношение Proteobacteria к Acidobacteria в ризосферных бактериальных сообществах является индикатором содержания питательных веществ в почве, где Proteobacteria были связаны с почвами, богатыми питательными веществами, а Acidobacteria — с почвами, бедными питательными веществами (Smit et al. ., 2001; Castro et al., 2010; Gottel et al., 2011). В эндофитных сообществах по большей части доминировали Proteobacteria , что свидетельствует о значительном перекрытии ключевых членов сообщества у разных видов хозяев (Gottel et al., 2011; Bulgarelli et al., 2012; Lundberg et al., 2012; Bodenhausen et al., 2013; Shakya et al., 2013; Romero et al., 2014).

Чтобы дать представление о бактериальных сообществах на уровне рода, мы определили базовое бактериальное сообщество, описываемое каждой парой праймеров, как 10 наиболее распространенных ОТЕ на уровне рода на компартмент.Это привело к 21 OTU для ризосферы, 18 OTU для корней и 23 OTU для образцов стебля и листа. Процент последовательностей, представленных этими 10 наиболее распространенными OTU для каждой пары праймеров и компартмента растения, приведен в таблицах S3 – S6. Для всех компонентов растений, и в частности для ризосферной почвы, мы наблюдали длиннохвостые кривые ранг-численность, характерные для микробных сообществ (Hartmann et al., 2012). Здесь стоит отметить, что для всех компартментов, за исключением листьев, наиболее часто идентифицируемые OTU были разными для каждой пары праймеров.Это демонстрирует основное влияние выбора праймера на наблюдаемые бактериальные сообщества. В ризосфере преобладающими ОТЕ были Actinomycetales (9,9%, 799F-1391R), Rhizobiales (11,3%, 799F-1193R) и Acidobacteria_Gp6 (15,7, 341F-783Rabc). В корнях основными идентифицированными ОТЕ были Pseudomonas (11,9%, 799F-1391R), Rhizobium (15,9%, 799F-1193R) и Rhizobiales (38,9%, 341F-783Rabc). В стеблях Pseudomonas (12.9%, 799F-1391R), Deinococcaceae (18,2%, 799F-1193R) и Sphingomonadaceae (34,2%, 341F-783Rabc) были наиболее наблюдаемыми ОТЕ. Наконец, в листьях Pseudomonas доминировали в бактериальных сообществах независимо от используемой пары праймеров.

На уровне рода наиболее примечательной является эффективность эндофитной колонизации OTU Pseudomonas , о чем свидетельствуют все изученные пары праймеров (таблицы S3 – S6). Низкая относительная численность Pseudomonas в ризосферной почве (0.От 3 до 1,9%) контрастирует с его преобладанием в выборках эндосферы (от 3,67 до 40,13%). Аналогичным образом, сравнительные исследования выявили высокую относительную численность OTU, подобного Pseudomonas , в корневом микробиоме Populus deltoides (Gottel et al., 2011), хотя новое исследование выявило аналогичное преобладание в эндосфере корня Streptomyces -подобные ОТУ (Shakya et al., 2013). Напротив, микробиота корней и листьев генотипов Arabidopsis , по-видимому, не сильно заселена Pseudomonas -подобными ОТЕ (Bulgarelli et al., 2012; Lundberg et al., 2012; Schlaeppi et al., 2014; Бай и др., 2015). Эндофитная колонизация Pseudomonas может происходить через ризосферу, где большинство эндофитных бактерий должно происходить из устьиц и / или через колонизацию устьиц листьев, поскольку было обнаружено, что образцы аэрозолей содержат многочисленные последовательности Pseudomonas (Fahlgren et al., 2010). Наконец, при интерпретации исследований сообщества с платформами секвенирования следующего поколения важно упомянуть число копий оперона 16S рРНК.Это количество копий может варьироваться в зависимости от вида, от 1 до 15, вносит значительную предвзятость и искажает представления о бактериальных сообществах (Crosby and Criddle, 2003; Lee et al., 2009). Кроме того, для полной оценки надежности и устойчивости праймеров в отношении систематической ошибки в отношении и / или в пользу конкретных таксономических групп и оценок богатства и разнообразия сообществ использование фиктивных сообществ позволит лучше понять их экспериментальное поведение во время исследований метабаркодирования (Caporaso et al. al., 2011; Пинто, Раскин, 2012).

Заключительные замечания

Мы экспериментально оценили эффективность семи пар праймеров 16S рДНК в исследованиях метабаркодирования 16S рДНК эндофитных и ризосферных бактериальных сообществ. Наши результаты показывают, что разные пары праймеров демонстрируют разную эффективность в удалении нецелевой ДНК. В этом исследовании пара праймеров 799F-1391R, которая амплифицирует гипервариабельные области V5-V7 гена 16S рДНК, показала очень низкую амплификацию нецелевой ДНК во всех отобранных компартментах растений.И извлекли наибольшее количество OTU, а также продемонстрировали самое высокое разнообразие инверсии Симпсона, особенно в компартментах растений с высоким содержанием хлоропластов (образцы стеблей и листьев). Поэтому мы предлагаем пару праймеров 799F-1391R как наиболее подходящую для исследований метабаркодирования 16S рДНК, которые одновременно исследуют ризосферные и эндосферные микробиомы. В частности, в экспериментальных установках, где проводятся прямые сравнения между различными микробиомами эндосферы, такими как микробиомы растений дикого типа и генетически модифицированных растений.Однако для проведения углубленной характеристики микробиомов ризосферы и / или эндосферы и выявления истинного бактериального разнообразия настоятельно рекомендуется использовать несколько пар праймеров.

В последнее время на передний план вышло использование других приложений для кодирования рДНК 16S, таких как платформы HiSeq2000, MiSeq Illumina и Ion Torrent (Claesson et al., 2010; Metzker, 2010; Caporaso et al., 2012; Logares et al. , 2013; Kennedy et al., 2014). Однако в исследованиях микробиоты растений применение этих платформ до сих пор в основном ограничивалось несколькими исследованиями микробиома ризосферы (Jiang et al., 2013; Panke-Buisse et al., 2014; Sun et al., 2014) и микробиоту корней и листьев (Ofek-Lalzar et al., 2014; Bai et al., 2015; Coleman-Derr et al., 2016). Оценка потенциала нашего оптимизированного подхода со специфическими для платформы модификациями (например, длиной ампликона) в сочетании с HiSeq2000 и MiSeq Illumina могла бы внести дополнительный вклад в профилирование сообществ ассоциированных с растениями бактериальных сообществ на основе 16S рДНК с высоким разрешением.

Авторские взносы

Концептуализация: BB, JV и WB; Методология: BB, MODB, SoT и SaT; Расследование: BB; Письменность — первоначальный черновик: BB; Написание — просмотр и редактирование: MODB, NW, WB и JV; Финансирование Приобретение: СП и ВБ.

Финансирование

Эта работа финансировалась Фондом научных исследований Фландрии (FWO-Vlaanderen), номер проекта G032912N, Ph.D. гранты для Мишеля Оп Де Бека, Софи Тийс и Саши Труйенс и грант на постдокументацию для Неле Вейенс. Кроме того, эта работа финансировалась проектом UHasselt Methusalem 08M03VGRJ.

Доступность данных

Файлы стандартного формата блок-схемы (SFF) были депонированы в архиве считывания последовательностей NCBI (SRA) под номером биопроекта PRJNA318176 и номерами доступа в BioSample SAMN04633889 на SAMN04633970.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fmicb.2016.00650

Список литературы

Эйрд, Д., Росс, М. Г., Чен, В.-С., Даниэльссон, М., Феннелл Т., Расс С. и др. (2011). Анализ и минимизация систематической ошибки амплификации ПЦР в библиотеках секвенирования Illumina. Genome Biol. 12: R18. DOI: 10.1186 / GB-2011-12-2-r18

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Андерсон, М. Дж., И Уиллис, Т. Дж. (2003). Канонический анализ главных координат: полезный метод условной ординации для экологии. Экология 84, 511–525. DOI: 10.1890 / 0012-9658 (2003) 084 [0511: CAOPCA] 2.0.CO; 2

CrossRef Полный текст | Google Scholar

Андерссон, А.Ф., Линдберг, М., Якобссон, Х., Бэкхед, Ф., Нюрен, П., и Энгстранд, Л. (2008). Сравнительный анализ микробиоты кишечника человека с помощью пиросеквенирования со штрих-кодом. PLoS ONE 3: e2836. DOI: 10.1371 / journal.pone.0002836

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эндрю Д. Р., Фитак Р. Р., Мунгиа-Вега А., Раколта А., Мартинсон В. Г. и Донцова К. (2012). Абиотические факторы формируют микробное разнообразие в почвах пустыни Сонора. Заявл. Environ. Microbiol. 78, 7527–7537. DOI: 10.1128 / AEM.01459-12

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Айядевара С., Таден Дж. Дж. И Шмуклер Рейс Р. Дж. (2000). Дискриминация несовпадения 3′-нуклеотидов праймера с помощью ДНК-полимеразы taq во время полимеразной цепной реакции. Анал. Biochem. 284, 11–18. DOI: 10.1006 / abio.2000.4635

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бай Ю., Мюллер Д. Б., Шринивас Г., Гарридо-Отер Р., Potthoff, E., Rott, M., et al. (2015). Функциональное перекрытие микробиоты листьев и корней Arabidopsis thaliana . Природа 528, 364–369. DOI: 10.1038 / природа16192

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бальцер, С., Мальде, К., и Йонассен, И. (2011). Систематическое исследование источников ошибок в данных блок-схемы пиросеквенирования. Биоинформатика 27, i304 – i309. DOI: 10.1093 / биоинформатика / btr251

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бекерс, Б., Оп Де Бек, М., Вайенс, Н., Ван Акер, Р., Ван Монтегю, М., Боэрджан, В. и др. (2016). Инженерия лигнина в выращиваемых в поле тополях влияет на бактериальный микробиом эндосферы. Proc. Natl. Акад. Sci. США 113, 2312–2317. DOI: 10.1073 / pnas.1523264113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Берри Д., Бен Махфуд К., Вагнер М. и Лой А. (2011). Праймеры со штрих-кодом, используемые в мультиплексной амплификации смещения пиросеквенирования ампликона. Заявл.Environ. Microbiol. 77, 7846–7849. DOI: 10.1128 / AEM.05220-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Боденхаузен, Н., Хортон, М. В., и Бергельсон, Дж. (2013). Бактериальные сообщества, связанные с листьями и корнями Arabidopsis thaliana . PLoS ONE 8: e56329. DOI: 10.1371 / journal.pone.0056329

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Брагина, А., Берг, К., Кардинале, М., Щербаков А., Чеботарь В., Берг Г. (2012). Сфагновые мхи обладают высокоспецифическим бактериальным разнообразием на протяжении всего своего жизненного цикла. ISME J. 6, 802–813. DOI: 10.1038 / ismej.2011.151

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Брей, Дж. Р., и Кертис, Дж. Т. (1957). Ординация горных лесных сообществ южного Висконсина. Ecol. Monogr. 27, 325–349.

Google Scholar

Булгарелли, Д., Ротт, М., Schlaeppi, K., Ver Loren van Themaat, E., Ahmadinejad, N., Assenza, F., et al. (2012). Выявление структуры и признаков сборки Arabidopsis бактериальной микробиоты, населяющей корни. Природа 488, 91–95. DOI: 10.1038 / природа11336

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Bulgarelli, D., Schlaeppi, K., Spaepen, S., Ver Loren van Themaat, E., and Schulze-Lefert, P. (2013). Структура и функции бактериальной микробиоты растений. Annu. Rev. Plant Biol. 64, 807–838. DOI: 10.1146 / annurev-arplant-050312-120106

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., et al. (2012). Сверхвысокопроизводительный анализ микробного сообщества на платформах Illumina HiSeq и MiSeq. ISME J. 6, 1621–1624. DOI: 10.1038 / ismej.2012.8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Капорасо, Дж.Г., Лаубер, К. Л., Уолтерс, В. А., Берг-Лайонс, Д., Лозупоне, К. А., Тернбо, П. Дж. И др. (2011). Глобальные паттерны разнообразия 16S рРНК на глубине миллионов последовательностей на образец. Proc. Natl. Акад. Sci. США 108, 4516–4522. DOI: 10.1073 / pnas.1000080107

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кастро, Х. Ф., Классен, А. Т., Остин, Э. Э., Норби, Р. Дж., И Шадт, К. У. (2010). Ответы почвенного микробного сообщества на многочисленные экспериментальные факторы изменения климата. Заявл. Environ. Microbiol. 76, 999–1007. DOI: 10.1128 / AEM.02874-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Челиус, М. К., и Триплетт, Э. У. (2001). Разнообразие архей и бактерий в ассоциации с корнями Zea mays L. Microb. Ecol. 41, 252–263. DOI: 10.1007 / s002480000087

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Клаэссон, М. Дж., Ван, К., О’салливан, О., Грин-Диниз, Р., Коул, Дж. Р., Росс, Р. П. и др. (2010). Сравнение двух технологий секвенирования следующего поколения для определения очень сложного состава микробиоты с использованием тандемных вариабельных участков гена 16S рРНК. Nucleic Acids Res. 38, е200. DOI: 10.1093 / nar / gkq873

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Коулман-Дерр, Д., Десгаренс, Д., Фонсека-Гарсия, К., Гросс, С., Клингенпил, С., Войке, Т. и др. (2016). Компонент растений и биогеография влияют на состав микробиома культурных и местных видов агавы. New Phytol. 209, 798–811. DOI: 10.1111 / nph.13697

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кортлевен А., Нобен Дж. П. и Валке Р. (2011). Анализ фотосинтетического аппарата трансгенных растений табака с измененным содержанием эндогенных цитокининов: протеомное исследование. Proteome Sci. 9, 1–14. DOI: 10.1186 / 1477-5956-9-33

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кросби, Л. Д., и Криддл, К.С. (2003). Понимание систематической ошибки в методах анализа микробного сообщества из-за неоднородности числа копий оперона rrn. Biotechniques 34, 790–794.

PubMed Аннотация | Google Scholar

Даниэльсен, Л., Лохаус, Г., Сирренберг, А., Карловский, П., Бастьен, К., Пилат, Г. и др. (2013). Эктомикоризная колонизация и разнообразие в отношении биомассы деревьев и питания на плантации трансгенных тополей с модифицированным биосинтезом лигнина. PLoS ONE 8: e59207.DOI: 10.1371 / journal.pone.0059207

PubMed Аннотация | CrossRef Полный текст | Google Scholar

ДеЛеон-Родригес, Н., Латем, Т. Л., Родригес, Р. Л. М., Баразеш, Дж. М., Андерсон, Б. Э., Бейерсдорф, А. Дж. И др. (2013). Микробиом верхней тропосферы: видовой состав и преобладание, влияние тропических штормов и атмосферные последствия. Proc. Natl. Акад. Sci. США 110, 2575–2580. DOI: 10.1073 / pnas.1212089110

PubMed Аннотация | CrossRef Полный текст

ДеСантис, Т.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E.L., Keller, K., et al. (2006). Greengenes, проверенная химерами база данных генов 16S рРНК и рабочая среда, совместимая с ARB. Заявл. Environ. Microbiol. 72, 5069–5072. DOI: 10.1128 / AEM.03006-05

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдгар Р. К., Хаас Б. Дж., Клементе Дж. К., Айва К. и Найт Р. (2011). UCHIME улучшает чувствительность и скорость обнаружения химер. Биоинформатика 27, 2194–2200.DOI: 10.1093 / биоинформатика / btr381

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эдвардс, Дж., Джонсон, К., Сантос-Медельин, К., Лурье, Э., Подишетти, Н. К., Бхатнагар, С. и др. (2015). Структура, вариация и сборка корневых микробиомов риса. Proc. Natl. Акад. Sci. США 112, E911 – E920. DOI: 10.1073 / pnas.14145

PubMed Аннотация | CrossRef Полный текст

Фальгрен, К., Хагстрём, А., Нильссон, Д., и Цвайфель, У. Л. (2010). Годовые колебания разнообразия, жизнеспособности и происхождения бактерий, переносимых по воздуху. Заявл. Environ. Microbiol. 76, 3015–3025. DOI: 10.1128 / AEM.02092-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фихери, Г. Р., Йигит, Э., Ойола, С. О., Лангхорст, Б. У., Шмидт, В. Т., Стюарт, Ф. Дж. И др. (2013). Метод селективного обогащения микробной ДНК из ДНК позвоночных-хозяев Highlander, SK (ed). PLoS ONE 8: e76096.DOI: 10.1371 / journal.pone.0076096

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Файнштейн, Л. М., Сул, В. Дж., И Блэквуд, К. Б. (2009). Оценка систематической ошибки, связанной с неполным извлечением микробной ДНК из почвы. Заявл. Environ. Microbiol. 75, 5428–5433. DOI: 10.1128 / AEM.00120-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ганс Дж., Волински М. и Данбар Дж. (2005). Усовершенствования вычислений показывают большое разнообразие бактерий и высокую токсичность металлов в почве. Наука 309, 1387–1390. DOI: 10.1126 / science.1112665 ​​

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гизелинк, Дж., Пфайффер, С., Хейлен, К., Сессич, А., Де Вос, П. (2013). Влияние выбора праймера и коротких последовательностей чтения на результаты исследований разнообразия гена 16S рРНК Ravel, J (ed). PLoS ONE 8: e71360. DOI: 10.1371 / journal.pone.0071360

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Жиль, А., Meglécz, E., Pech, N., Ferreira, S., Malausa, T., and Martin, J.-F. (2011). Оценка точности и качества пиросеквенирования титана 454 GS-FLX. BMC Genomics 12: 245. DOI: 10.1186 / 1471-2164-12-245

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Готтель, Н. Р., Кастро, Х. Ф., Керли, М., Янг, З., Пеллетье, Д. А., Подар, М. и др. (2011). Отчетливые микробные сообщества корней Populus deltoides в эндосфере и ризосфере на разных типах почв. Заявл. Environ. Microbiol. 77, 5934–5944. DOI: 10.1128 / AEM.05255-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Грин, С. Дж., И Минц, Д. (2005). Ограничение эндонуклеазой суицидной полимеразы, новый метод усиления ПЦР-амплификации минорных ДНК-матриц. Заявл. Environ. Microbiol. 71, 4721–4727. DOI: 10.1128 / AEM.71.8.4721-4727.2005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хамдан, Л.Дж., Коффин, Р. Б., Сикаруди, М., Грейнерт, Дж., Тройд, Т., и Жиллеве, П. М. (2013). Океанские течения формируют микробиом морских отложений Арктики. ISME J. 7, 685–696. DOI: 10.1038 / ismej.2012.143

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hartmann, M., Howes, C.G., VanInsberghe, D., Yu, H., Bachar, D., Christen, R., et al. (2012). Существенное и стойкое воздействие лесозаготовок на микробные сообщества почв в северных хвойных лесах. ISME J. 6, 2199–2218. DOI: 10.1038 / ismej.2012.84

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Консорциум проекта по микробиому человека (2012 г.). Структура, функции и разнообразие микробиома здорового человека. Природа 486, 207–214. DOI: 10.1038 / природа11234

PubMed Аннотация | CrossRef Полный текст

Инчеоглу, О., Саллес, Дж. Ф., ван Овербек, Л., и ван Эльзас, Дж. Д. (2010). Влияние генотипа растений и стадии роста на сообщества бета-протеобактерий, ассоциированных с разными сортами картофеля на двух полях. Заявл. Environ. Microbiol. 76, 3675–3684. DOI: 10.1128 / AEM.00040-10

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Jiang, X. T., Peng, X., Deng, G.H., Sheng, H.F., Wang, Y., Zhou, H. W., et al. (2013). Секвенирование с помощью Illumina метки 16S рРНК выявило пространственные вариации бактериальных сообществ на мангровых болотах. Microb. Ecol. 66, 96–104. DOI: 10.1007 / s00248-013-0238-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Календарь, Р., Ли, Д., и Шульман, А. Х. (2014). Программное обеспечение FastPCR для ПЦР, in silico ПЦР ​​и сборки и анализа олигонуклеотидов, в DNA Cloning and Assembly Methods, Methods in Molecular Biology , eds S. Valla and R. Lale (Humana Press), 271–302.

PubMed Аннотация

Кеннеди К., Холл М. В., Линч М. Д. Дж., Морено-Хагельсиб Г. и Нойфельд Дж. Д. (2014). Оценка смещения бактериальных профилей гена 16S рРНК на основе иллюминации. Заявл. Environ. Microbiol. 80, 5717–5722.DOI: 10.1128 / AEM.01451-14

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Клиндворт, А., Прюсс, Э., Швир, Т., Пеплис, Дж., Кваст, К., Хорн, М. и др. (2013). Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований и исследований разнообразия на основе секвенирования следующего поколения. Nucleic Acids Res. 41, 1–11. DOI: 10.1093 / nar / gks808

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кунин В., Энгельбрексон А., Охман, Х., Гугенгольц, П. (2010). Морщины в редкой биосфере: ошибки пиросеквенирования могут привести к искусственному завышению оценок разнообразия. Environ. Microbiol. 12, 118–123. DOI: 10.1111 / j.1462-2920.2009.02051.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, Т. К., Ван Доан, Т., Ю, К., Чой, С., Ким, К., Пак, Дж. И др. (2010). Обнаружение обычно существующих микробов анодной биопленки в двух различных МФЦ для очистки сточных вод с использованием пиросеквенирования FLX Titanium. Заявл. Microbiol. Biotechnol. 87, 2335–2343. DOI: 10.1007 / s00253-010-2680-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, З. М. П., Буссема, К., Шмидт, Т. М. (2009). rrnDB: документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. 37, 489–493. DOI: 10.1093 / nar / gkn689

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лефевер С., Паттин Ф., Хеллеманс Дж. И Вандесомпеле Дж.(2013). Однонуклеотидные полиморфизмы и другие несоответствия снижают эффективность количественных ПЦР-анализов. Clin. Chem. 59, 1470–1480. DOI: 10.1373 / Clinchem.2013.203653

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Логарес, Р., Сунагава, С., Салазар, Г., Корнехо-Кастильо, Ф. М., Феррера, И., Сарменто, Х. и др. (2013). Метагеномные метки 16S рДНК Illumina — мощная альтернатива секвенированию ампликонов для изучения разнообразия и структуры микробных сообществ. Environ. Microbiol. 16, 2659–2671. DOI: 10.1111 / 1462-2920.12250

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лой А., Майкснер Ф., Вагнер М. и Хорн М. (2007). probeBase — онлайн-ресурс для олигонуклеотидных зондов, нацеленных на рРНК: новые возможности 2007. Nucleic Acids Res. 35, D800 – D804. DOI: 10.1093 / nar / gkl856

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лундберг, Д. С., Лебейс, С. Л., Паредес, С.Х., Юрстон С., Геринг Дж., Малфатти С. и др. (2012). Определение основного микробиома корня Arabidopsis thaliana . Природа 488, 86–90. DOI: 10.1038 / nature11237

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лундберг, Д. С., Юрстон, С., Мечковски, П., Джонс, К. Д., и Дангл, Дж. Л. (2013). Практические инновации для высокопроизводительного секвенирования ампликонов. Nat. Методы 10, 999–1002. DOI: 10.1038 / nmeth.2634

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Луо, К., Цеменци, Д., Кирпидес, Н., Рид, Т., и Константинидис, К. Т. (2012). Прямое сравнение технологий секвенирования Illumina и Roche 454 на одном и том же образце ДНК микробного сообщества Родригес-Валера, Ф. (ред.). PLoS ONE 7: e30087. DOI: 10.1371 / journal.pone.0030087

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лутц, К. А., Ван, В., Здепски, А., Майкл, Т. П. (2011). Выделение и анализ высококачественной ядерной ДНК с пониженным содержанием органелл для секвенирования и повторного секвенирования генома растений. BMC Biotechnol. 11:54. DOI: 10.1186 / 1472-6750-11-54

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Маргулис М., Эгхолм М., Альтман В. Э., Аттия С., Бадер Дж. С., Бембен Л. А. и др. (2005). Секвенирование генома в микропроцессорных пиколитровых реакторах высокой плотности. Природа 437, 376–380. DOI: 10.1038 / nature03959

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Макаллистер, С. М., Дэвис, Р. Э., Макбет, Дж.М., Тебо Б. М., Эмерсон Д. и Мойер К. Л. (2011). Биоразнообразие и новая биогеография нейтрофильных железоокисляющих зетапротеобактерий. Заявл. Environ. Microbiol. 77, 5445–5457. DOI: 10.1128 / AEM.00533-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Mendes, R., Kruijt, M., de Bruijn, I., Dekkers, E., van der Voort, M., Schneider, J.H.M, et al. (2011). Расшифровка микробиома ризосферы на наличие болезнетворных бактерий. Наука 332, 1097–1100.DOI: 10.1126 / science.1203980

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Морхарт, К., Шеппард, Дж., И Спикер, Х. (2013). Надземная безлистная древесная биомасса и содержание питательных веществ в различных компартментах клона тополя P. maximowicii × P. trichocarpa . Леса 4, 471–487. DOI: 10.3390 / f4020471

CrossRef Полный текст | Google Scholar

Накамура, К., Осима, Т., Моримото, Т., Икеда, С., Yoshikawa, H., Shiwa, Y., et al. (2011). Профиль ошибок секвенсоров Illumina для конкретных последовательностей. Nucleic Acids Res. 39, е90. DOI: 10.1093 / nar / gkr344

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нельсон, М.С., Моррисон, Х.Г., Бенджамино, Дж., Грим, С.Л., и Граф, Дж. (2014). Анализ, оптимизация и проверка полученных с помощью illumina ампликонов гена 16S рРНК Обзоры Heimesaat, MM (ed). PLoS ONE 9: e

. DOI: 10.1371 / journal.pone.00

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Офек-Лалзар М., Села Н., Гольдман-Воронов М., Грин С. Дж., Хадар Ю. и Минц Д. (2014). Функциональные сигнатуры микробиома поверхности корня, связанные с нишами и хозяином. Nat. Commun. 5, 4950. DOI: 10.1038 / ncomms5950

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Оксанен, Дж., Бланше, Г. Ф., Киндт, Р., Лежандр, П., Минчин, П. Р., О’Хара, Р. Б. и др.(2013). vegan: Пакет «Экология сообщества». Пакет R версии 2.15.1. Доступно в Интернете по адресу: http://CRAN.R-project.org/package=vegan

Оп де Бек, М., Ливенс, Б., Бушарт, П., Деклерк, С., Вангронсвельд, Дж., И Колпарт, Дж. В. (2014). Сравнение и проверка некоторых пар праймеров ITS, полезных для исследований метаболического кодирования грибов. PLoS ONE 9: e. DOI: 10.1371 / journal.pone.00

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ойола, С.О., Гу, Ю., Манске, М., Отто, Т. Д., О’Брайен, Дж., Олкок, Д. и др. (2013). Эффективное устранение загрязнения ДНК хозяина при клиническом секвенировании малярии. J. Clin. Microbiol. 51, 745–751. DOI: 10.1371 / journal.pone.0076096

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Панке-Буисс К., Пул А. К., Гудрич Дж. К., Лей Р. Э. и Као-Книффин Дж. (2014). Выбор почвенного микробиома показывает воспроизводимое влияние на функцию растений. ISME J. 9, 980–989. DOI: 10.1038 / ismej.2014.196

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Парамешваран П., Джалили Р., Тао Л., Шокралла С., Гаризаде Б., Ронаги М. и др. (2007). Дизайн нуклеотидного штрих-кода, специально разработанный для пиросеквенирования, открывает возможности для крупномасштабного мультиплексирования образцов. Nucleic Acids Res. 35, e130. DOI: 10.1093 / nar / gkm760

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пайффер, Дж.А., Спор А., Корен О., Джин З., Триндж С. Г., Дангл Дж. Л. и др. (2013). Разнообразие и наследуемость микробиома ризосферы кукурузы в полевых условиях. Proc. Natl. Акад. Sci. США 110, 6548–6553. DOI: 10.1073 / pnas.1302837110

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пинто, А. Дж., И Раскин, Л. (2012). Ошибки ПЦР искажают структуру бактериальных и архейных сообществ в наборах данных пиросеквенирования Bertilsson, S (ed). PLoS ONE 7: e43093.DOI: 10.1371 / journal.pone.0043093

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Помпанон, Ф., Дигл, Б. Э., Симондсон, У. О. К., Браун, Д. С., Джарман, С. Н., и Таберлет, П. (2012). Кто что ест: оценка диеты с использованием секвенирования следующего поколения. Мол. Ecol. 21, 1931–1950. DOI: 10.1111 / j.1365-294X.2011.05403.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Прюсс, Э., Кваст, К., Книттель, К., Фукс, Б.М., Людвиг В., Пеплис Дж. И др. (2007). SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Res. 35, 7188–7196. DOI: 10.1093 / nar / gkm864

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K. S., Manichanh, C., et al. (2010). Каталог микробных генов кишечника человека, созданный путем метагеномного секвенирования. Природа 464, 59–65.DOI: 10.1038 / nature08821

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., et al. (2013). Проект базы данных генов рибосомных РНК SILVA: улучшенная обработка данных и веб-инструменты. Nucleic Acids Res. 41, D590 – D596. DOI: 10.1093 / nar / gks1219

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Rastogi, G., Tech, J. J., Coaker, G. L., and Leveau, J.Х. Дж. (2010). Набор инструментов на основе ПЦР для независимой от культуры количественной оценки общей численности бактерий в среде растений. J. Microb. Методы 83, 127–132. DOI: 10.1016 / j.mimet.2010.08.006

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рэйвен, П. Х. (1970). Множественное происхождение пластид и митохондрий: многие независимые симбиотические события могли быть вовлечены в происхождение этих клеточных органелл. Наука 169, 641–646. DOI: 10.1126 / наука.169.3946.641

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Редфорд, А. Дж., Бауэрс, Р. М., Найт, Р., Линхарт, Ю., и Фирер, Н. (2010). Экология филлосферы: географическая и филогенетическая изменчивость в распространении бактерий на листьях деревьев. Environ. Microbiol. 12, 2885–2893. DOI: 10.1111 / j.1462-2920.2010.02258.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ромеро, Ф. М., Марина, М., и Pieckenstain, F. L. (2014). Сообщества эндофитных бактерий листьев томата ( Solanum lycopersicum L.), проанализированные методом пиросеквенирования гена 16S-рибосомной РНК. FEMS Microbiol. Lett. 351, 187–194. DOI: 10.1111 / 1574-6968.12377

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сагарам, США, ДеАнгелис, К. М., Триведи, П., Андерсен, Г. Л., Лу, С. Е. и Ван, Н. (2009). Анализ бактериального разнообразия цитрусовых, инфицированных патогеном Huanglongbing, с использованием массивов PhyloChip и секвенирования библиотеки клонов гена 16S рРНК. Заявл. Environ. Microbiol. 75, 1566–1574. DOI: 10.1128 / AEM.02404-08

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сакаи, М., Мацука, А., Комура, Т., и Канадзава, С. (2004). Применение нового ПЦР-праймера для анализа полиморфизма длин концевых рестрикционных фрагментов бактериальных сообществ в корнях растений. J. Microbiol. Методы 59, 81–89. DOI: 10.1016 / j.mimet.2004.06.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сантханам, Р., Гротен, К., Мелдау, Д. Г., и Болдуин, И. Т. (2014). Анализ взаимодействия растений и бактерий в их естественной среде обитания: бактериальные сообщества, связанные с диким табаком, не зависят от эндогенных уровней жасмоновой кислоты и стадий развития Саймон ван Овербек, Л. (ред.). PLoS ONE 9: e

. DOI: 10.1371 / journal.pone.00

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ширмер М., Иджаз, У. З., Д’Амор, Р., Холл, Н., Слоан, В. Т., и Айва, К.(2015). Анализ смещений и ошибок секвенирования при секвенировании ампликонов с помощью платформы Illumina MiSeq. Nucleic Acids Res. 43, е37. DOI: 10.1093 / nar / gku1341

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шлаеппи, К., Домбровски, Н., Отер, Р. Г., Вер Лорен ван Темат, Э., и Шульце-Леферт, П. (2014). Количественное расхождение микробиоты бактериальных корней у сородичей Arabidopsis thaliana . Proc. Natl. Акад. Sci. НАС.А. 111, 585–592. DOI: 10.1073 / pnas.13215

PubMed Аннотация | CrossRef Полный текст

Шлосс, П. Д., Весткотт, С. Л., Рябин, Т., Холл, Дж. Р., Хартманн, М., Холлистер, Э. Б. и др. (2009). Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом для описания и сравнения сообществ микробов. Заявл. Environ. Microbiol. 75, 7537–7541. DOI: 10.1128 / AEM.01541-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тень, А., Макманус, П.С., и Хандельсман, Дж. (2013). Неожиданное разнообразие во время сукцессии сообщества в микробиоме цветков яблони. MBio 4, 1–12. DOI: 10.1128 / mBio.00602-12.Editor

PubMed Аннотация | CrossRef Полный текст

Шакья М., Готтель Н., Кастро Х., Янг З. К., Гюнтер Л., Лаббе Дж. И др. (2013). Многофакторный анализ структуры грибных и бактериальных сообществ в корневом микробиоме зрелых деревьев Populus deltoides . PLoS ONE 8: e76382.DOI: 10.1371 / journal.pone.0076382

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шейвер, Дж. М., Ольденбург, Д. Дж., И Бендич, А. Дж. (2006). Изменения ДНК хлоропластов в процессе развития у табака, Medicago truncatula, гороха и кукурузы. Planta 224, 72–82. DOI: 10.1007 / s00425-005-0195-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Зибрехт, С., Хердель, К., Шурр, У., и Тишнер, Р. (2003). Транслокация питательных веществ в ксилеме тополя-суточные вариации и пространственное распределение вдоль оси побега. Planta 217, 783–793. DOI: 10.1007 / s00425-003-1041-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Смит, Э., Лифланг, П., Гомманс, С., ван Мил, С., и Вернарс, К. (2001). Разнообразие и сезонные колебания доминирующих членов бактериального почвенного сообщества на пшеничном поле, определяемые методами культивирования и молекулярными методами. Заявл. Environ. Microbiol. 67, 2284–2291. DOI: 10.1128 / AEM.67.5.2284

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Согин, М.Л., Моррисон, Х. Г., Хубер, Дж. А., Марк Велч, Д., Хьюз, С. М., Нил, П. Р. и др. (2006). Разнообразие микробов в морских глубинах и в малоизученной «редкой биосфере». Proc. Natl. Акад. Sci. США 103, 12115–12120. DOI: 10.1073 / pnas.0605127103

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Стронг, М. Дж., Сюй, Г., Моричи, Л., Сплинтер Бон-Дюран, С., Бадду, М., Лин, З. и др. (2014). Микробное загрязнение при секвенировании следующего поколения: значение для анализа клинических образцов на основе последовательностей Rall, GF (ed). PLoS Pathog. 10: e1004437. DOI: 10.1371 / journal.ppat.1004437

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Судакаран, С., Салем, Х., Кост, К., и Кальтенпот, М. (2012). Географическая и экологическая стабильность симбиотической микробиоты среднего кишечника европейских светлячков, Pyrrhocoris apterus (Hemiptera, Pyrrhocoridae). Мол. Ecol. 21, 6134–6151. DOI: 10.1111 / mec.12027

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сан, Дж., Чжан, К., Чжоу, Дж., И Вэй, К. (2014). Секвенирование ампликона 16S рРНК с помощью Illumina выявляет развитие бактериального сообщества в ризосфере питомников яблони на месте повторной посадки болезни и на новом участке посадки. PLoS ONE 9: e111744. DOI: 10.1371 / journal.pone.0111744

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Sun, L., Qiu, F., Zhang, X., Dai, X., Dong, X., and Song, W. (2008). Эндофитное бактериальное разнообразие риса ( Oryza sativa L.) корни оценивали с помощью анализа последовательности 16S рДНК. Microb. Ecol. 55, 415–424. DOI: 10.1007 / s00248-007-9287-1

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Tremblay, J., Singh, K., Fern, A., Kirton, E. S., He, S., Woyke, T., et al. (2015). Влияние праймера и платформы на секвенирование метки 16S рРНК. Фронт. Microbiol. 6: 771. DOI: 10.3389 / fmicb.2015.00771

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Триведи, П., Дуань, Ю., и Ван, Н. (2010). Хуанлунбин, системное заболевание, реструктурирует бактериальное сообщество, связанное с корнями цитрусовых. Заявл. Environ. Microbiol. 76, 3427–3436. DOI: 10.1128 / AEM.02901-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ван Акер, Р., Лепле, Дж. К., Аэртс, Д., Сторм, В., Гёминн, Г., Ивенс, Б. и др. (2014). Улучшение осахаривания и выхода этанола из трансгенного тополя, выращенного в полевых условиях, с дефицитом циннамоил-КоА-редуктазы. Proc. Natl. Акад. Sci. США 111, 845–850. DOI: 10.1073 / pnas.1321673111

PubMed Аннотация | CrossRef Полный текст

Ванхольм Р., Демедтс Б., Моррил К., Ральф Дж. И Бурджан В. (2010). Биосинтез и структура лигнина. Plant Physiol. 153, 895–905. DOI: 10.1104 / стр.110.155119

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уокер, Дж. Дж., И Пейс, Н. Р. (2007). Филогенетический состав эндолитических микробных экосистем скалистых гор. Заявл. Environ. Microbiol. 73, 3497–3504. DOI: 10.1128 / AEM.02656-06

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уолтерс, В. А., Капорасо, Дж. Г., Лаубер, К. Л., Берг-Лайонс, Д., Фирер, Н., и Найт, Р. (2011). PrimerProspector: de novo Дизайн и таксономический анализ праймеров для ПЦР. Биоинформатика 27, 1159–1161. DOI: 10.1093 / биоинформатика / btr087

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вайнерт, Н., Пичено, Ю., Динг, Г.-К., Майнке, Р., Хойер, Х., Берг, Г. и др. (2011). Гибридизация PhyloChip выявила огромное бактериальное разнообразие в ризосфере различных сортов картофеля: много распространенных таксонов и несколько таксонов, зависящих от сорта. FEMS Microbiol. Ecol. 75, 497–506. DOI: 10.1111 / j.1574-6941.2010.01025.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

границ | Оценка пар праймеров гена 16S рРНК для мониторинга структур микробного сообщества показала высокую воспроизводимость в пределах и низкую сопоставимость между наборами данных, созданными с помощью нескольких пар праймеров архей и бактерий

Введение

Изучение состава микробного сообщества позволяет детально изучить разнообразие и потенциальную функцию экосистемы и способствует пониманию сложных микробных процессов (Vanwonterghem et al., 2014). В последние годы наблюдается значительный рост подходов к секвенированию, направленных на микробные сообщества посредством секвенирования ампликонов или метагеномных и метатранскриптомных подходов (Turnbaugh et al., 2007; Hamady et al., 2008; Raes and Bork, 2008; Caporaso et al., 2012; Grosskopf и Сойер, 2014; Ининбергс и др., 2015). Эти подходы играют важную роль в мониторинге и сравнении большого количества образцов с точки зрения их микробного состава (Caporaso et al., 2012; Kozich et al., 2013; Sundberg et al., 2013). Наиболее часто используемый маркер для изучения разнообразия прокариот — это 16S рРНК или соответствующий ей ген. Первыми, кто выполнил обширные исследования на основе области 16S, были Вёзе и Фокс (Woese, Fox, 1977; Woese et al., 1990). Их глубокая и страстная работа привела к открытию третьей области жизни — архей (Woese et al., 1990). С тех пор вклад архей в функцию и разнообразие экосистемы часто недооценивался во многих областях исследований.Хотя бактериальная фракция многих сред была широко изучена, археи часто не рассматривались специально. Эту недооценку вклада архей в биологию можно наблюдать в различных исследованиях, от подходов, основанных на секвенировании по Сэнгеру, до исследований, основанных на высокопроизводительном секвенировании на основе 454 и MiSeq (Frank et al., 2007; Herlemann et al., 2011; Ding и Schloss, 2014; Wang et al., 2015). Во многих отчетах, посвященных архее, исследуются такие экстремальные условия, как горячие источники (Beam et al., 2015), глубоководные вулканы (Reysenbach et al., 2006) и черные курильщики (Takai and Nakamura, 2011), и это лишь некоторые из них, что еще больше способствует популяризации архей как экстремофилов. Напротив, археи повсеместно встречаются в довольно мезофильных условиях, таких как пресные и морские воды (DeLong, 1992; DeLong et al., 1994; Karner et al., 2001; Stahl and de la Torre, 2012), биогазовые реакторы (Sundberg et al., 2013), почвы (Leininger et al., 2006), кишечного тракта термитов (Paul et al., 2012), жвачных животных (Jeyanathan et al., 2011; Kittelmann et al., 2013), но также на коже человека (Probst et al., 2013; Oh et al., 2014) или в кишечнике (недавно рассмотрено в Bang and Schmitz, 2015), где они завершают микробиом вместе со своими бактериальными, эукариотическими и вирусными партнерами.

Что касается биогеохимических циклов, археи обладают уникальной чертой метаногенного пути (Offre et al., 2013). Выбросы метана в результате деятельности архей используются в промышленных масштабах в качестве полезного источника возобновляемой энергии в биогазовых реакторах, но это проблематично, если рассматривать их с точки зрения выбросов парниковых газов.Двумя основными источниками антропогенной эмиссии метана являются животноводство и поля рисовой лепешки (Yusuf et al., 2012), две среды обитания, в которых, как известно, обитают метаногенные сообщества архей (Janssen and Kirs, 2008; Kittelmann et al., 2013; Breidenbach and Conrad, 2014). и оба вносят заметный вклад в общие антропогенные выбросы парниковых газов (Wuebbles, 2002; Ripple et al., 2014). Кроме того, производство метана в животноводстве кишечным сообществом приводит к потере энергии для хозяина из-за выброса богатого энергией метана, и в нескольких исследованиях изучаются потенциальные ингибиторы производства метана архей (Goel and Makkar, 2012; Duin et al., 2016). Таким образом, сообщества архей жвачных животных в последние годы были в центре внимания нескольких исследований (Skillman et al., 2004; Jeyanathan et al., 2011; Kim et al., 2011; Singh et al., 2012; Tymensen and McAllister, 2012; Kittelmann et al., 2013; Henderson et al., 2015), некоторые из них включают оценку праймеров для сообщества архей (Watanabe et al., 2004; Gantner et al., 2011) или расширение исследования микробиома путем добавления результатов для простейших и грибов (Kittelmann et al., 2013).

В обширном исследовании Klindworth et al.(2013) выполнили подробную оценку in-silico набора данных праймеров 16S рРНК, содержащего 175 праймеров и 512 пар праймеров, с 72 праймерами, нацеленными на последовательности гена 16S архей. Праймеры и пары праймеров были протестированы с использованием неизбыточной справочной базы данных SILVA 16S для оценки их точности и филогенетического охвата. Вдохновленные этим исследованием, мы проверили экспериментальную применимость нескольких комбинаций праймеров — некоторые из них были рекомендованы в вышеупомянутом исследовании, другие были дополнены на основе обзора литературы.После первоначальной проверки in-silico были выбраны шесть наиболее многообещающих пар праймеров; три нацелены на архейную последовательность, две — на бактериальную и одна — на общую прокариотическую последовательность гена 16S рРНК. Эти пары праймеров показали высокий охват и специфичность in-silico и были использованы для исследования микробного сообщества анаэробного мезофильного биогазового реактора, среды обитания, в которой, как известно, обитает разнообразное сообщество архей и бактерий (Eikmeyer et al., 2013; Sundberg et al., 2013). Чтобы устранить деструктивные эффекты и обеспечить максимальную сопоставимость, мы использовали одну и ту же матричную ДНК, выделенную из одного образца вышеупомянутого биогазового реактора для всех подходов.Метагеномные подходы с дробовиком были внедрены в анализ сообществ (Venter et al., 2004) и обладают дополнительным преимуществом, заключающимся в том, что помимо таксономической информации указывают на потенциал экосистемы (Vanwonterghem et al., 2014). Отказ от амплификации гена 16S рРНК — еще один положительный эффект метагеномики дробовика, поскольку он опровергает данные о смещении праймеров (Shakya et al., 2013; Logares et al., 2014; Tremblay et al., 2015). Таким образом, в качестве дополнительного и независимого подхода мы использовали данные о гене 16S рРНК, полученные в рамках комплексного подхода к метагеномному секвенированию того же материала биогазового ферментера (Güllert et al., 2016) в качестве ориентира для сравнения.

Это исследование направлено на оценку влияния выбора праймера на наблюдаемый состав последовательностей разнообразного микробного сообщества. В отличие от других исследований, посвященных оценке бактериальных праймеров 16S рРНК, мы сосредоточены здесь на оценке и наблюдении за сообществом архей более подробно. Мы также критически обсуждаем надежность оценки праймера in-silico с точки зрения неспецифической амплификации и целевой специфичности при применении к образцам окружающей среды.Кроме того, профили сообщества на основе ампликона гена 16S рРНК сравнивали с последовательностями гена 16S рРНК, извлеченными и собранными из метагеномных данных дробовика.

Материалы и методы

Образец анаэробного ила

Для экстракции нуклеиновых кислот один образец был взят из мезофильной (40 ° C) полномасштабной биогазовой установки (выходная мощность 540–580 кВтч), расположенной недалеко от Кельна (Германия) 27 мая 2013 года. Основным субстратом для анаэробного сбраживания была кукуруза. силос (69%), навоз КРС (19%) и сухой помет птицы (12%).PH реактора составлял 7,96, летучие жирные кислоты 3,06 г эквивалента уксусной кислоты / л, общий неорганический углерод 17,7 г CaCO 3 / л, свободный аммиак 2,98 г / л. Один литр материала образца был взят в стандартных условиях и сохранен при 4 ° C во время транспортировки в лабораторию, где он хранился при -20 ° C до экстракции ДНК.

Экстракция ДНК

Два миллилитра замороженного образца гомогенизировали перед экстракцией с использованием механической ступки Dismembrator-U (Sartorius Stedim Biotech GmbH, Геттинген, Германия) в течение 5 минут при 2.500 об. / Мин. ДНК экстрагировали из гомогената с помощью протокола на основе CTAB (цетримония бромида) -хлороформ: изоамиловый спирт, как описано Weiland et al. (2010). Из-за высокой концентрации гуминовых кислот в конечных экстрактах ДНК ДНК была дополнительно очищена с помощью набора FastDNA ™ SPIN для почвы (MP Biomedicals, Solon, UH, USA). После экстракции чистоту проверяли спектрофотометрически с помощью флуороспектрометра NanoDrop 1000 (Thermo Fisher Scientific, Бремен, Германия) путем измерения оптической плотности при 260 и 280 нм (260/280 = 1.57).

Выбор грунтовки 16S и оценка

In-silico

Три разные пары праймеров, нацеленные на область гена 16S рРНК архей, были выбраны из недавних публикаций (Takai and Horikoshi, 2000; Baker et al., 2003; Yu et al., 2005; Frank et al., 2007; Fierer et al., 2008; Park et al., 2008; Morales, Holben, 2009; Claesson et al., 2010; Herlemann et al., 2011; Klindworth et al., 2013). Основными критериями для их выбора были (i) in-silico , указываемые для архей, (ii) низкая систематическая ошибка при амплификации конкретных групп прокариот и (iii) длина ампликона от 250 до 600 пар оснований (п.н.), подходящая для следующих: методы секвенирования поколения, такие как 454 Pyrosequencing или Illumina MiSeq.Две пары праймеров, нацеленные на бактериальный ген 16S рРНК (Lane et al., 1985; Hamady and Knight, 2009; Herlemann et al., 2011), и одна пара праймеров для бактериального и архейного гена 16S рРНК (Klindworth et al., 2013) были выбран с применением тех же критериев.

In-silico Оценка выбранных праймеров была выполнена с использованием онлайн-инструментов arb-SILVA TestPrime и TestProbe (Klindworth et al., 2013) с использованием неизбыточной базы данных малых субъединиц SILVA 16S (ssu r123, SILVA Ref NR; Pruesse et al., 2007). Результаты для протестированных праймеров и пар праймеров перечислены в таблицах 1, 2.

Таблица 1. In-silico результаты оценки выбранных праймеров .

Таблица 2. Результаты оценки in-silico выбранных пар праймеров .

ПЦР и подготовка библиотеки

Праймеры

каждой протестированной пары праймеров включали набор адаптеров 454 A, последовательность штрих-кода с уникальным идентификатором и последовательность линкера, как описано ранее (Langfeldt et al., 2014). Для каждой пары праймеров были выполнены пять отдельных препаратов ПЦР с 5 индивидуальными идентификаторами для исследования экспериментальной воспроизводимости. Выделенную ДНК доводили до концентрации 20 нг / мкл и использовали в качестве матрицы в реакциях амплификации. Реакционные смеси для ПЦР состояли из 17,25 мкл H 2 O (Carl Roth, Карлсруэ, Германия), 250 нМ прямого и обратного праймера (MWG, Ebersberg, Германия), 5 мкл 5-кратного буфера для реакции Phusion HF, 250 нМ смеси dNTP. , 0,5 ед. ДНК-полимеразы Phusion HF (Thermo Fisher Scientific, Бремен, Германия) и 40 нг матрицы.Температура отжига для каждой пары праймеров была предварительно рассчитана с использованием онлайн-инструмента Tm Calculator от NEB [версия 1.8.1; New England Biolabs, Ipswitch (MA), США (http://tmcalculator.neb.com)]. Условия цикла для ПЦР-амплификации начинались с начальной стадии денатурации в течение 30 с при 95 ° C, за которыми следовали 30 циклов по 10 с при 95 ° C, 45 с при соответствующей температуре отжига и 30 с при 72 ° C и окончательное продление для 10 мин при 72 ° C. Все реакции проводили в трех экземплярах с одним соответствующим отрицательным контролем.Отрицательный контроль не содержал ДНК-матрицы в реакционной смеси для ПЦР и не показал амплификации. Ампликоны проверяли на правильную длину и очищали электрофорезом в агарозном геле с использованием набора для экстракции геля MinElute (Qiagen, Hilden, Германия), как ранее описано у Langfeldt et al. (2014). Концентрация ДНК в элюатах составляла от 7,9 до 77,5 нг / мкл, как было определено с помощью спектрофотометра Nanodrop ND 1000 (Thermo Fisher Scientific, Бремен, Германия). Образцы объединяли в пуле для секвенирования в равных концентрациях.Секвенирование было выполнено MWG в соответствии с рекомендациями производителя на системе Roche 454 GS-FLX ++ с использованием химии титанового секвенирования в двух циклах секвенирования.

Обработка последовательности ампликона

Последовательности

обрабатывали с использованием Mothur v1.35.1 (Schloss et al., 2009), как описано в Weiland-Bräuer et al. (2015) со следующими модификациями. Поскольку некоторые праймеры содержали вырожденные позиции, последовательности, содержащие до пяти различий в области праймера и одно различие в области штрих-кода, были сохранены в наборе данных.Были сохранены только последовательности со средним баллом Phred (Ewing et al., 1998; Ewing and Green, 1998) ≥25 и максимум восемь гомополимеров. Каждый набор данных праймеров анализировали отдельно. Выравнивание последовательностей выполняли против сравнительных сравнений бактерий и архей на основе SILVA (Release 102; Pruesse et al., 2007). Процедуру выравнивания, этап фильтрации, удаление химерных последовательностей и таксономическую классификацию выполняли в отношении версии 123 базы данных SILVA в формате mothur (Pruesse et al., 2007). Для дальнейшей обработки и сравнения между образцами в наборе данных, используемом для сравнения разнообразия, сохранялись только интересующие области (археи, бактерии или оба). Неклассифицированные последовательности или последовательности из домена, не являющегося мишенью для соответствующей пары праймеров, удаляли. На этапе классификации был получен файл tax.summary, в котором перечислено количество классифицированных таксонов в каждом образце для каждой пары праймеров. Для сравнения между разными парами праймеров файлы tax.summary разных пар праймеров были объединены с помощью команды merge.налоговая сводка.

Каждый набор данных далее давал общий файл, в котором перечислялось распределение таксономических единиц (OTU) по образцам для данной пары праймеров. Эти файлы использовались при расчете индексов α-разнообразия на уровне сходства 97 и 99%.

Секвенирование, сборка и аннотации метагенома

Последовательности, соответствующие обсуждаемому здесь образцу биогазового реактора, были извлечены из метагеномных данных (Güllert et al., 2016), доступных под регистрационным номером PRJNA301928 (http: // www.ncbi.nlm.nih.gov/bioproject/PRJNA301928). Извлеченные чтения были обрезаны с использованием программного обеспечения Trimmomatic v0.30 (Bolger et al., 2014). Для выделения последовательностей гена 16S рРНК использовали программу reago v1.1 (Yuan et al., 2015). 336424 чтения были идентифицированы как последовательности гена 16S рРНК и собраны с использованием ассемблера Spades (Bankevich et al., 2012), генерируя 286 контигов с длиной> 200 п.н. и охватом выше 2. N 50 сгенерированных контигов составляли 336 п.н. Перед дальнейшим анализом информация о покрытии и длине использовалась для нормализации численности контигов.Таксономическая аннотация последовательностей метагеномного гена 16S рРНК была выполнена с помощью Mothur (Schloss et al., 2009). Последовательности, содержащие неоднозначные основания и / или последовательности короче 250 п.н., удаляли. Остальные 198 уникальных контигов были таксономически классифицированы по базе данных SILVA (версия 123; Pruesse et al., 2007).

Последовательности

Amplicon доступны через ncbi (http://www.ncbi.nlm.nih.gov/bioproject/PRJNA315559) под PRJNA315559.

Весь последующий вычислительный анализ был выполнен в R v3.2.1 (R Core Team, 2015) с использованием веганского пакета версии 2.3-5 (Оксанен и др., 2015).

Для расчета альфа-разнообразия использовались OTU, сгенерированные конвейером mothur на уровне сходства 97 и 99% после удаления синглтонов. Подсчеты OTU были преобразованы в относительную численность на образец, и OTU с численностью ниже 0,2% в соответствующем наборе данных праймеров были отклонены. Индекс разнообразия Шеннона (H) был рассчитан с использованием уравнения 1 из отфильтрованных относительных подсчетов OTU с использованием веганской функции разнообразия () .Эквивалент чисел Шеннона ( 1 D) был рассчитан с использованием уравнения (2) на основе разнообразия Шеннона, которое было установлено в качестве экспоненты с основанием e , чтобы получить 1 D (Legendre and Legendre, 1998).

H = −∑i = 1Npiln (pi) (1)
1D = e (−∑i = 1N piln (pi)) = eH (2)

, где p i = n i / N — относительное, а n i — абсолютное количество видов i и N — общее количество видов в пределах набор данных.

Бета-разнообразие было рассчитано отдельно для бактериального и архейного домена на основе объединенных файлов tax.summary, в которых перечислено количество таксономических бункеров для каждого образца. Эта таблица численности на образец была преобразована и нормализована с использованием уравнения Хеллингера, показанного в уравнении (3) (Legendre and Gallagher, 2001). Преобразованные данные Хеллингера использовались для расчета матрицы несходства Брея-Кертиса по уравнению (4) (Legendre and Legendre, 1998), а также для анализа избыточности (RDA).

Где y ij — численность видов i на участке j и y j + — сумма всех видов на участке j .

DBrayCurtis (i, j) = 1-∑k = 0n | yik-yjk | ∑k = 0n (yik + yjk) (4)

, где несходство ( D BrayCurtis ) между сообществом двух участков ( i, j ), k как индекс численности видов и y ik обилие видов i на сайте к .

Результаты

Primers Show High

In-silico Покрытие

Праймеры

для амплификации генов 16S рРНК архей и бактерий были выбраны таким образом, чтобы избежать амплификации последовательностей за пределами обозначенного домена. Праймеры, предназначенные для амплификации гена 16S рРНК архей и бактерий, показали высокое покрытие in-silico для обоих доменов (от 66 до 96%). Все оцененные праймеры для архейного домена покрывали ≥81% всех типов в базе данных SILVA, представленной в январе 2016 г. (ssu r123, SILVA Ref NR).Бактериальные праймеры показали еще более высокий теоретический охват, более 90% (см. Таблицу 1). Исключением был праймер S-D-Bact-0007-a-S-20, который соответствовал только 66% типов бактерий в базе данных. Праймеры, разработанные для комбинированной амплификации последовательностей генов 16S рРНК архей и бактерий, показали в целом самый высокий теоретический охват, нацеленный на 95,7% всех последовательностей архей и 92,3% всех бактериальных последовательностей. Когда допускалось одно несовпадение в паре оснований праймеров, охват праймеров, предназначенных для амплификации последовательностей гена 16S рРНК архей, увеличивался до покрытия ≥87% всех типов в SILVA.Аналогичное увеличение до ≥95% всех бактериальных типов в базе данных SILVA наблюдалось для праймеров, нацеленных на последовательности бактериального гена 16S рРНК. Указание на возможную ложную амплификацию, указанную теоретическим охватом за пределами обозначенного домена, наблюдали для праймеров SD-Arch-0787-aS / A-20, SD-Bact-0341-bS-17 и SD-Bact-0907-aA-20. . Праймеры S-D-Bact-0907-a-A-20, S-D-Bact-0785-a-A-21 и S-D-Arch-0519-a-S-15 показали потенциальное покрытие эукариотического домена (0,8–92,4%). Учитывая одно несоответствие во время процесса отжига, вероятность ложной амплификации вне целевого домена увеличивалась в вышеупомянутых праймерах и дополнительно наблюдалась в праймерах SD-Arch-0349-aS-17 и SD-Bact-0338-aA-19 в незначительные количества (таблица 1).

Праймеры

были объединены в пары, как указано в таблице 2. Оценка In-silico показала, что пары ArchV46 и BacV35 являются наиболее многообещающими парами для амплификации последовательностей гена 16S рРНК архей и бактерий соответственно. Пары праймеров, выбранные для амплификации последовательностей гена прокариотической 16S рРНК, охватывают 88,6% архей и 88,2% бактериальных типов в базе данных in-silico .

Высокое снижение считывания во время обработки последовательностей гена 16S рРНК архей было вызвано неспецифической амплификацией

Отобранные пары праймеров, разработанные для домена архей, показали низкую специфичность при практическом применении.На рисунке 1 показана классификация считывания ампликонов до этапа фильтрации на основе таксономии. Процент последовательностей ампликонов, классифицированных как архейные после этапа выравнивания и аннотации, колеблется от 64,5 до 10,89% в случае праймеров, предназначенных для обнаружения архей. В наборах данных праймеров, разработанных для амплификации бактериального гена 16S рРНК, более 99% последовательностей ампликона были классифицированы как бактериальные (данные не показаны). Соотношение последовательностей архей и бактерий в наборе данных, созданном с помощью прокариотических праймеров, составляло 3.2–96,8% (см. Рис. 1). Неархейные последовательности в наборах данных архей происходили в основном из бактериальных областей гена 16S рРНК, что указывает на неспецифическую амплификацию с помощью тестируемых пар праймеров архей. Уменьшение считывания в конвейере mothur визуализировано для каждой пары праймеров на рисунке 2 и обобщено в таблице S1. В парах праймеров ArchV46 и ArchV34 при фильтрации по целевому домену (команда get.lineague ) наблюдалось сильное сокращение количества последовательностей в наборах данных.Пары праймеров, нацеленные на область бактериального гена 16S рРНК, а также пара праймеров PrkV4 и ArchV56, показали лишь незначительное снижение на этой стадии фильтрации. Уменьшение на этом конкретном этапе обработки намекает на удаление неклассифицированных последовательностей, а также последовательностей из нецелевых доменов.

Рис. 1. Процент последовательностей, классифицированных как архейные в наборах данных, созданных с применением праймеров, нацеленных на область гена архейной рибосомной РНК 16S. 100% относится ко всем последовательностям в отдельных наборах данных, в то время как процент считываний, классифицированных как археи, указан прямоугольниками, стандартное отклонение между n = 5 повторами указано полосами.

Фиг. 2. Уменьшение последовательности для сравниваемых пар праймеров гена 16S рРНК во время различных этапов конвейера анализа мотыльков . 100% относится к количеству всех последовательностей в каждом наборе данных в начале конвейера аннотации последовательностей Mothur.

Таксономический состав различается в зависимости от используемой пары праймеров

Таксономическая аннотация последовательности в наборах данных, созданных тестируемыми парами праймеров и извлеченных из метагенома (фракция гена 16S рРНК), показана на рисунке 3 для архейной части на уровне порядка, а также на рисунке 4 для бактериальной часть на уровне класса.

Фигура 3. Составы последовательностей сообществ, наблюдаемые различными парами праймеров архей и прокариот на уровне порядка . Показаны пять повторов каждой пары праймеров, а также последовательности гена 16S рРНК, извлеченные из метагенома (16S-MG). Аннотация сделана с использованием базы данных SILVA v123. Таксоны с численностью менее 1% были сгруппированы как «прочие».

Фигура 4. Составы последовательностей сообществ, наблюдаемых различными парами бактериальных и прокариотических праймеров на уровне класса .Показаны пять повторов каждой пары праймеров, а также последовательности гена 16S рРНК, извлеченные из пары данных метагенома (16S-MG). Аннотация сделана с использованием базы данных SILVA v123. Таксоны с численностью менее 1% были сгруппированы как «прочие».

В домене архей все пары праймеров идентифицировали последовательности, аннотированные как Methanosarcinales , как наиболее доминирующий порядок (45–66% последовательностей в наборах данных), за которым следует Methanomicrobiales , достигая от 17 до 43% соответственно. Метанобактерии были третьей по численности группой с относительной численностью от 6 до 15%. 1–5% наблюдаемых последовательностей были аннотированы как Methanomassiliicoccales , Thermoplasmatales , родственный метаногенному отряду архей (Paul et al., 2012; Sollinger et al., 2016). Общий состав сообщества соответствовал результатам, основанным на последовательностях метагеномного гена 16S рРНК. Здесь последовательности, классифицированные как Methanosarcinales , были наиболее доминирующей группой с 50%, за которой следовала Methanomicrobiales с 43%.Последовательности, классифицированные как Methanobacteriales и Methanomassiliicoccales , каждая составляла 4% сообщества.

В последовательностях бактериального домена преобладали классы Clostridia (23–42%), Bacteroidia (10–23%), OPB54, принадлежащие к Firmicutes (12–19%) и Mollicutes . (6–21%), что вместе составляет более 67% всех последовательностей в наборах данных на основе праймеров. Исключением были некультивируемые « Candidatus » Cloacimonetes из подразделения-кандидата SHA-4, принадлежащие к Spirochaetes .Последовательности этих организмов были обнаружены почти исключительно с парой праймеров BacV35, где на ее долю приходилось 17% всех последовательностей.

Что касается последовательностей гена 16S рРНК, выделенных из метагенома, наиболее заметным наблюдением было более высокое содержание последовательностей « Candidatus » Cloacimonas (16%) и меньшее количество Clostridia (только 18%) по сравнению с грунтовочный метод. Bacteroidia (16%) и Mollicutes (2%) также были среди очень распространенных таксонов.Кроме того, последовательности гена 16S рРНК без классификации ниже уровня домена были более многочисленными по сравнению с подходами на основе ампликонов. Доля последовательностей, происходящих от архей, составила 2,4%, тогда как 97,6% последовательностей были классифицированы как бактерии.

Анализ альфа-разнообразия сильно отличался между протестированными парами праймеров

Альфа-разнообразие было проанализировано для различных наборов данных на основе состава OTU, созданного на уровне сходства последовательностей 99% (см. Рисунок 5), а также для уровня сходства последовательностей 97% (см. Рисунок S2), оба обобщенных в таблице 3.Наблюдаемое разнообразие зависит от (i) способности амплифицированной области различать различные таксономические единицы, (ii) порогового значения сходства для разделения OTU и (iii) диапазона видов, амплифицированных парой праймеров. На уровне сходства 99% наборы данных пар праймеров ArchV34 показали более низкое медианное альфа-разнообразие 5,7 для домена архей, разнообразие было сравнительно высоким на основе пары праймеров ArchV46, ArchV56 и PrkV4 с 7,2, 7,6 и 8,8. Напротив, альфа-разнообразие было в целом выше в наборах бактериальных данных.Бактериальное разнообразие, наблюдаемое с парой праймеров PrkV4, было особенно высоким — 40,5, в то время как пары праймеров BacV12 и BacV35 приводили к числам Шеннона, эквивалентным 21,8 и 34,7, соответственно.

Рис. 5. Альфа-разнообразие (эквивалент чисел Шеннона), наблюдаемое на уровне 99% OTU в тестируемых наборах данных архей (A) и бактерий (B), амплифицированных с парами праймеров ( n = 5) после удаления синглетонов и низкая численность ОТЕ (менее 0,2%) .

Таблица 3. Обобщение потенциала протестированных пар праймеров in-silico и в приложении .

Измерение бета-разнообразия

Для сравнения вариаций в наблюдаемом составе последовательности архей и бактерий бета-разнообразие было проанализировано с применением анализа избыточности (RDA), основанного на численности таксономических групп на уровне рода. Поэтому объединенные файлы tax.summary, содержащие информацию о численности различных родов в сообществах, наблюдаемых парами праймеров, были преобразованы в таблицу таксонов на сайт.Этот подход, основанный на таксономии, был выбран, поскольку сравнение на обычном уровне OTU между разными парами праймеров было невозможно. После преобразования Хеллингера данных подсчета была рассчитана матрица несходства Брея-Кертиса. Результаты показаны в виде тепловой карты на рисунке 6. Более высокое сходство обозначено красным цветом, тогда как низкое сходство между наблюдаемыми сообществами обозначено белым. Кластеризация репликатов в парах праймеров архей (рис. 6А) наблюдалась для ArchV34, ArchV34 и ArchV56, а также для четырех из пяти реплик пар праймеров PrkV4.В наборе данных о бактериях кластеризация реплик была более сильной по сравнению с набором данных об архее (рис. 6В).

Фиг. 6. Тепловая карта, полученная на основе матрицы несходства расстояний Брея-Кертиса между составами сообществ архей (А) и бактерий (В), наблюдаемых с помощью пар праймеров и выделенных последовательностей метагеномного гена 16S рРНК . Сходство между образцами обозначается как цветовой градиент от большего сходства (красный) к меньшему (белый).

Анализ избыточности на основе данных, преобразованных Хеллингером, был выполнен с использованием команды rda в R с «парами праймеров» в качестве объясняющего фактора. Общие скорректированные отклонения, объясненные первыми двумя измерениями RDA, как показано на рисунке 7, составили 69,35% для набора данных об архей (рисунок 7A) и 83,53% для набора данных по бактериям (рисунок 7B). Четко разделенные кластеры разных наборов данных указывают на конкретное изображение сообщества для каждой пары праймеров. Модель была проверена на значимость с помощью дисперсионного анализа (ANOVA) с использованием команды anova с 1000 перестановками.Результаты показали высокую значимость для архей [ F (3, 16) = 15,336; p = 0,001] и бактериальный [ F (2, 12) = 36,509; p = 0,001] модели. При значимости полной модели были проведены попарные сравнения между соответствующими наборами пар праймеров для архей и бактерий. Процедура Бенджамини-Хохберга была применена для исправления значений p с учетом попарного тестирования (Benjamini and Hochberg, 1995).Значения F варьировались от 53,791 до 6,4614 с соответствующими значениями q от 0,0132 до 0,0260 для архейных данных (обобщены в Таблице S2). Значения F для попарного тестирования пар бактериальных праймеров варьировались от 52,012 до 29,381 с соответствующими значениями q от 0,0135 до 0,0140 (суммированы в таблице S3).

Рис. 7. RDA на основе данных подсчета таксонов, преобразованных по Хеллингеру, после расчета несходства Брея-Кертиса . Четкое разделение различных пар праймеров можно наблюдать между разными сообществами архей (A) и бактерий (B) , наблюдаемых в образце.Восемь (археи) и 10 (бактерии) таксонов, которые вносят наибольший вклад в дисперсию набора данных, показаны как векторы.

Для дальнейшего изучения различий между наблюдаемыми структурами сообществ были определены индикаторные таксоны, как описано ранее Weiland-Bräuer et al. (2015) с помощью команды multipatt из R package indicspecies v.1.7.1 (Cáceres and Legendre, 2009) с 10 5 перестановками. Индикаторные таксоны характерны для определенной среды или, как в нашем случае, для пары праймеров.Следовательно, анализ индикаторных видов может указывать на возможную переоценку или недооценку определенных таксонов тестируемыми парами праймеров, что является важным критерием выбора и надежности праймеров. Было обнаружено, что шесть индикаторных таксонов из архейного домена являются характерными в наборах данных для различных пар праймеров (обобщены в Таблице S4). Последовательности, классифицированные как Methanosphaera и Methanoculleus , оказались характерными для сообществ, наблюдаемых с помощью пары праймеров ArchV34, тогда как сообщества, амплифицированные парой праймеров ArchV46, в большей степени характеризовались присутствием последовательностей, аннотированных как Methanobacterium и Methanosarcina .Пара прокариотических праймеров PrkV4 была охарактеризована последовательностями Methanobrevibacter и Methanomassiliicoccus . В наборе данных, созданном с помощью пары праймеров ArchV56, не было обнаружено особо характерного таксона.

Для бактериального домена анализ индикаторных таксонов обнаружил, что 10 таксонов являются характерными для различных пар праймеров (обобщены в таблице S5). BacV12 был охарактеризован последовательностями, аннотированными как некультивируемый WCHB1 69, принадлежащим Sphingobacteriales, Ruminiclostridium , а также некультивируемыми таксонами, аннотированными как Mollicutes, Clostridia и Bacteroidales .Последовательности, обозначенные как некультивируемые Cloacimonetes , были характерны для пары праймеров BacV35. Пара праймеров PrkV4 содержала Ruminiclostridium, Gelria , а также две не охарактеризованные последовательности, аннотированные как Clostridiaceae и Bacteroidetes , которые оказались характерными для набора данных. Интересно, что наблюдаемые индикаторные таксоны не коррелировали с более высоким охватом базы данных in-silico пары праймеров для этого конкретного таксона и, следовательно, не могут быть предсказаны на основе анализа базы данных.Вышеупомянутые индикаторные таксоны внесли наибольший вклад в дисперсию, объясняемую RDA, и визуализированы в виде векторов на Рисунке 7.

Обсуждение

Выбор пары праймеров для амплификации гена 16S рРНК в значительной степени определяет качество и перспективность полученных данных сообщества. Многочисленные недавние исследования затрагивают тему сопоставимости проектов, основанных на генах 16S рРНК, демонстрируя влияние различных эффектов с помощью фиктивных сообществ и смоделированных наборов данных (Schloss et al., 2011; Brooks et al., 2015; Tremblay et al., 2015). Однако сложность образцов окружающей среды не может быть полностью воспроизведена искусственно созданными сообществами, и эффекты, связанные с выбором пар праймеров для анализа сложных образцов окружающей среды, остаются под вопросом. В то время как большинство вышеупомянутых исследований сосредоточено в основном на бактериях, здесь мы представили исчерпывающие данные, полученные для архей и бактериальной фракции сложной среды, где мы наблюдали сходные тенденции эффектов праймеров в обоих доменах.По нашим результатам можно сформулировать пять основных утверждений:

(A) Все пары праймеров смогли восстановиться и представить типичное сложное микробное сообщество анаэробного биогазового реактора, но с другим результатом, касающимся деталей структуры сообщества. Последовательности ключевых организмов для основных стадий гидролиза, ацидогенеза и ацетогенеза, в основном принадлежащих к Clostridia, Bacteroidia и Actinobacteria , наблюдались во всех наборах бактериальных данных.Наборы данных об археях предоставили последовательности видов, способных к гидрогенотрофному, ацетокластическому и метилотрофному метаногенезу (Wirth et al., 2012; Sundberg et al., 2013). Четкое ранжирование таксономических порядков по численности ( Methanosarcinales > Methanomicrobiales > Methanobacteriales Methanomassiliicoccales ), особенно в последовательностях сообщества архей, последовательно сохранялось во всех тестируемых парах праймеров, а также в последовательностях, полученных из метагеном.Точно так же порядок ранжирования двух наиболее распространенных классов бактерий ( Clostridia > Bacteroidia ) сохранялся в изобилии последовательностей во всех наборах бактериальных данных. В последовательностях гена 16S рРНК, полученных из метагенома, классы Clostridia и Bacteroidia были очень многочисленными (18 и 16%), но, кроме того, последовательности неклассифицированных Cloacimonetes составляли 16% в наборе данных (рис. 4). Этот таксон был бы упущен при использовании пар праймеров BacV12 или PrkV4 при анализе окружающей среды.Организмы этого класса были недавно обнаружены в наборах метагеномных данных из анаэробных дигестеров (Solli et al., 2014) и, как ожидается, будут участвовать в синтрофической деградации жирных кислот и белковых промежуточных продуктов (Pelletier et al., 2008; Limam et al., 2014) . Более низкая доля Clostridia в последовательностях метагеномного гена 16S рРНК может указывать на переоценку этого класса в подходах на основе ампликонов. В нашем случае наиболее многообещающей комбинацией для анализа сообщества образца была бы комбинация пар праймеров BacV35 и ArchV46, однако метагеномные последовательности по-прежнему демонстрируют другое общее бактериальное и архейное сообщество по сравнению с тем, которое наблюдается при использовании этих пар праймеров ( Рисунок 6).

(B) С технической точки зрения эффективность сильно различалась между оцениваемыми парами праймеров, а именно из-за неспецифической амплификации парами праймеров архей. В то время как 65% необработанных считываний из пары праймеров ArchV56 можно было использовать для анализа, уменьшение количества считываний для пары праймеров ArchV34 оставило только 11% исходных считываний для окончательного анализа сообщества архей. Чтения, отфильтрованные из наборов данных архей, в основном принадлежали к бактериальной области с высокой численностью класса « Candidatus » Cloacimonas .Хотя почти все удаленные последовательности из пары праймеров ArchV34 принадлежали к этому классу, последовательности, удаленные из наборов данных праймеров ArchV46 и ArchV56, показали более высокое разнообразие, но, как и ожидалось, не были сопоставимы по составу с тестируемыми парами бактериальных праймеров (Рисунок S1). . Низкая специфичность пары праймеров ArchV34 в отношении архей не была предсказана инструментом Silva TestPrime (Klindworth et al., 2013), причина этого неясна. Один из праймеров, примененных в этой паре праймеров, S-D-Arch-0787-a-A-20, показал потенциальную неспецифическую амплификацию в бактериальном домене в предсказании in-silico .Необъяснимым образом, тот же самый праймер был использован в качестве обратного комплемента в паре праймеров ArchV56, которая показала самую высокую специфичность из всех протестированных пар праймеров архей. Это показывает, что результат прогонов секвенирования по-прежнему крайне непредсказуем, и результаты базы данных не могут быть напрямую перенесены в приложение влажной лаборатории.

(C) Альфа-разнообразие (числа Шеннона, эквивалентные 1 D) различались между парами праймеров. В целом, более высокое наблюдаемое альфа-разнообразие для конкретной пары праймеров указывает на более высокое разрешение настоящего разнообразия (т.е.е. лучшее разделение OTU) в данном образце. Альфа-разнообразие в целом, а также эквиваленты числа Шеннона были ниже в наборах данных архей по сравнению с бактериальными. Это наблюдение ранее было сделано для сопоставимых биогазовых реакторов (Francisci et al., 2015). Эквивалент чисел Шеннона был выбран в качестве показателя альфа-разнообразия, поскольку он более надежен при применении в данных об окружающей среде и может рассматриваться как количество одинаково численных видов, необходимых для формирования разнообразия, наблюдаемого в данном наборе данных (Jost et al., 2010). Для праймеров, нацеленных на регионы гена 16S рРНК архей, наблюдаемое альфа-разнообразие хорошо коррелирует с предсказанием охвата базы данных (см. Таблицу 3). Высокая вариабельность наблюдалась для пар праймеров ArchV46 ( 1 D = 7,23) и PrkV4 ( 1 D = 8,81), охватывающих сильно вариабельную область V4 (Cai et al., 2013). Таким образом, в сочетании с высоким потенциалом охвата различных типов ArchV46 представляется весьма многообещающим и недавно был применен для анализа архейного домена в мезофильных анаэробных дигестерах (Goux et al., 2015). Высокое разнообразие, наблюдаемое в наборе данных PrkV4, хорошо коррелирует с высоким теоретическим охватом, предсказанным оценкой in-silico . В нашем исследовании численность доменов Archaea и Bacteria была сходной в общей метагеномной (2,4–97,6%) и основанной на ампликоне (3,2–96,8%) последовательностях гена 16S рРНК, генерируемых парой праймеров PrkV4, таким образом, не обнаруживая сильного сдвига в пропорции двух доменов во время генерации ампликона. Набор данных ArchV56 показал разнообразие в пределах того же диапазона, что хорошо коррелировало с прогнозируемым покрытием in-silico .Наблюдаемая положительная корреляция между охватом базы данных in-silico и наблюдаемым разнообразием также действительна для тестируемых пар бактериальных праймеров.

(D) Анализ бета-разнообразия показал хорошую воспроизводимость в пределах пары праймеров, но плохую сопоставимость между парами праймеров, как показано на тепловой карте (рис. 6). Существенные различия между сообществами, амплифицированными тестируемыми парами праймеров, являются результатом дифференциальной амплификации последовательностей гена 16S рРНК из одного и того же исходного материала, а также способности амплифицированной вариабельной области различать разные таксоны (Shakya et al., 2013; Tremblay et al., 2015). Этот перекос в амплификации и классификации также считается причиной наблюдаемых различий по сравнению с последовательностями, полученными из метагенома. Сравнение последовательностей гена 16S рРНК из метагеномных данных ранее показало, что они соответствуют последовательностям ампликона 16S рРНК, полученным из образцов окружающей среды, таких как рубец барана (Shi et al., 2014). Для набора данных об архей, созданного с помощью PrkV4, мы наблюдали более низкую кластеризацию в RDA (Рисунок 7A), а также более высокую внутригрупповую дисперсию, что уже можно было наблюдать в составе сообщества (Рисунок 3).Это произошло из-за общей более низкой глубины секвенирования архей в этом наборе данных. Как упоминалось ранее, общая численность архей в наборе данных составляла 3,2% по сравнению с также целевыми бактериальными последовательностями. Как описано Kittelmann et al. (2013), применение наборов праймеров, специфичных для нескольких доменов, может быть полезным, когда в среде обитания можно наблюдать сильные различия в количестве различных доменов. В вышеупомянутом исследовании сообщества рубца нескольких жвачных животных были исследованы путем применения нескольких конкретных наборов праймеров, нацеленных на бактерии, археи, простейшие и грибы, и объединены в чередующихся пропорциях для секвенирования с учетом различной численности микробиоты рубца (Kittelmann et al. al., 2013). В заключение, чтобы уменьшить внутригрупповые вариации набора данных об архей PrkV4, необходимо увеличить количество последовательностей для насыщающего анализа домена архей с использованием общей пары праймеров PrkV4. В качестве альтернативы для исследуемой среды обитания может быть полезен отдельный анализ архейного и бактериального домена.

(E) Дать совет о том, какую пару праймеров использовать, сложно, если вообще возможно, поскольку выбор зависит от среды обитания и исследовательского вопроса.Однако мы суммировали результаты, полученные в этом исследовании, в таблице 3, чтобы лучше сравнить недостатки пар праймеров, испытанных в представленном исследовании. Пара праймеров ArchV34 показала наибольшее сходство с архейным доменом метагеномных результатов. Тем не менее, его нельзя полностью рекомендовать, поскольку он крайне неспецифичен для последовательностей архей. По этой причине только 11% последовательностей, полученных для этой пары праймеров, можно было использовать для анализа. Пара праймеров ArchV46 показала умеренную специфичность и высокое разнообразие, что делает ее надежным кандидатом для исследования новых таксонов архей в различных средах.Он был успешно применен в недавнем мультиомическом подходе к исследованию архейной области анаэробного рисового поля. В этой сложной среде ему удалось обнаружить сложное сообщество архей, состоящее в основном из Methanomicrobia, Methanomassiliicoccales и Methanobacteria , а также около Thermoprotei (Ogawa et al., 2014). Пара праймеров ArchV56 показала самую высокую специфичность к последовательностям гена 16S рРНК архей. По сравнению с метагеномным сообществом архей наблюдаемое разнообразие и сходство были средними, что делает эту пару праймеров достойным выбором для обнаружения архей, особенно в средах с низкой численностью архей.В сочетании с флуоресцентным зондом эта пара праймеров была первоначально разработана для количественного определения архей (Yu et al., 2005) и применялась в этом контексте в различных исследованиях (Lee et al., 2008; Nettmann et al., 2008). . Помимо хорошего теоретического охвата и высокого разнообразия, явным преимуществом пары праймеров PrkV4 является одновременная амплификация последовательностей гена 16S рРНК архей и бактерий, что может быть полезно при исследовании синергизма между доменами архей и бактерий в окружающей среде.Это преимущество уже было подтверждено в других экологических исследованиях, таких как исследование связанной с кораллами микробиоты, содержащей значительные количества Thaumarchaeota и незначительные количества Euryarchaeota , которые были впервые обнаружены в слизи кораллов (van Bleijswijk et al. , 2015). К сожалению, по сравнению с последовательностями бактериального гена 16S рРНК, выделенными из метагенома, последовательности, полученные с помощью пары праймеров PrkV4, показали наименьшее сходство.Одна известная пара прокариотических праймеров применяется в проекте земного микробиома (Caporaso et al., 2012). Пара праймеров PrkV4 показала более высокое покрытие in-silico по сравнению с тем, что использовалось в проекте земного микробиома, однако это исследование не может обеспечить прямое сравнение. Пара праймеров BacV12 до сих пор использовалась в различных медицинских и экологических исследованиях (Rausch et al., 2011; Cozen et al., 2013; Langfeldt et al., 2014; Mensch et al., 2016). Даже несмотря на то, что пара праймеров высевала наибольшее сходство с бактериальным доменом, наблюдаемым в метагеноме, низкий теоретический охват и низкое наблюдаемое разнообразие в образцах могут указывать на возможное несоблюдение данных видов.Средние результаты с точки зрения разнообразия и сходства с метагеномными результатами наблюдались для пары праймеров BacV35. Амплификация высоко вариабельной области 4 гена 16S рРНК квалифицирует эту пару праймеров как хорошего кандидата, когда основное внимание уделяется только бактериальному домену (Güllert et al., 2016).

Таким образом, наиболее выгодным представляется использование одной и той же пары праймеров при сравнении различных сайтов или сред с помощью секвенирования ампликона. Это предположение ранее было сделано для бактериальных сообществ (Baker et al., 2003; Франк и др., 2008; Tremblay et al., 2015) и, как показано здесь, также справедливо для пар праймеров архей. Следует отметить, что дополнительные эффекты, влияющие на наблюдаемую структуру сообщества, также проявляются в виде экстракции нуклеиновых кислот (LaMontagne et al., 2002; Brooks et al., 2015), применяемых наборов (Adams et al., 2015), артефактов ПЦР. (Schloss et al., 2011; Brooks et al., 2015) и смещение базы данных (Werner et al., 2012), а также смещение, вносимое выбранной гипервариабельной областью (Chakravorty et al., 2007; Yu et al., 2008), сама платформа секвенирования (Kim et al., 2011; Luo et al., 2012; Tremblay et al., 2015) или центр секвенирования (Hiergeist et al., 2016). Кроме того, сопоставимость между сообществами, проанализированными с помощью различных пар праймеров, связана с таксономически назначенными последовательностями и, следовательно, ограничена и подвержена смещению из-за полноты базы данных (Werner et al., 2012). Эти аспекты дополнительно подчеркивают необходимость общих стандартов при планировании и проведении микробиологических исследований окружающей среды с целью улучшения сопоставимости, как и у людей (Turnbaugh et al., 2007; Peterson et al., 2009) или руководящие принципы проекта земного микробиома (Gilbert et al., 2010) с подробным и подробным руководством и инструкциями по подготовке проб, которые очень помогают для сопоставимости результатов между исследованиями. Наконец, сравнение с последовательностями гена 16S рРНК, полученными из соответствующего метагенома, как представлено здесь, кажется очень полезным и может быть рекомендовано в качестве дополнения к имитационному тестированию сообщества (Brooks et al., 2015; Tremblay et al., 2015) для оценки новых пар праймеров архей или бактерий, особенно когда состав сообщества в исследуемой среде еще не определен.

Авторские взносы

MF разработал исследование, провел эксперименты, проанализировал и интерпретировал данные и написал рукопись. SG предоставила метагеномные данные и разработала исследование. SN поддержала статистический анализ данных секвенирования. WS предоставил метагеномные данные и разработал исследование. RS разработал исследование, основал и руководил работой. Все авторы внесли свой вклад в рукопись и участвовали в процессе написания.

Финансирование

Финансовая поддержка была предоставлена ​​проектом BMBF BioPara, финансируемым РС (грант №03SF0421B) и WS (грант № 03SF0421H). Мы благодарим Землю Шлезвиг-Гольштейн за финансовую поддержку в рамках программы финансирования Open Access Publikationsfonds.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим компании Bioreact и Bonalytic GmbH (Тройсдорф, Германия), особенно Dr.Мелани Хехт и дипл. BioIng. Томасу Дикхаусу за предоставленный материал для ферментера биогазовой установки и за определение параметров химического процесса. Далее мы хотели бы поблагодарить Анн Купчок за поддержку в области биоинформатики.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/article/10.3389/fmicb.2016.01297

Список литературы

Банкевич А., Нурк С., Антипов Д., Гуревич А.А., Дворкин М., Куликов А.С. и др. (2012). SPAdes: новый алгоритм сборки генома и его приложения для секвенирования отдельных клеток. J. Comput. Биол. 19, 455–477. DOI: 10.1089 / cmb.2012.0021

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бим, Дж. П., Джей, З. Дж., Шмид, М. К., Руш, Д. Б., Ромайн, М. Ф., Дженнингс, Р. М. и др. (2015). Экофизиология некультивируемой линии Aigarchaeota из кислородного, нитчатого «стримерного» сообщества горячих источников. ISME J. 10, 210–224. DOI: 10.1038 / ismej.2015.83

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бенджамини Ю. и Хохберг Ю. (1995). Контроль ложного обнаружения — практичный и эффективный подход к множественному тестированию. Дж. Рой. Стат. Soc. Сер. B Methodol. 57, 289–300. DOI: 10.2307 / 2346101

CrossRef Полный текст | Google Scholar

Болджер А. М., Лозе М. и Усадель Б. (2014). Trimmomatic: гибкий триммер для данных последовательности Illumina. Биоинформатика 30, 2114–2120. DOI: 10.1093 / биоинформатика / btu170

PubMed Аннотация | CrossRef Полный текст

Брейденбах Б. и Конрад Р. (2014). Сезонная динамика метаногенных сообществ бактерий и архей на затопленных рисовых полях и влияние дренажа. Фронт. Microbiol. 5: 752. DOI: 10.3389 / fmicb.2014.00752

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Брукс, Дж. П., Эдвардс, Д. Дж., Харвич, М. Д., Ривера, М.С., Феттвейс, Дж. М., Серрано, М. Г. и др. (2015). Правда о метагеномике: количественная оценка противодействия систематической ошибке в исследованиях 16S рРНК. BMC Microbiol. 15:66. DOI: 10.1186 / s12866-015-0351-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Цай, Л., Е, Л., Тонг, А. Х., Лок, С., и Чжан, Т. (2013). Смещенные показатели разнообразия, выявленные бактериальными пиротагами 16S, полученными из различных наборов праймеров. PLoS ONE 8: e53649. DOI: 10,1371 / журнал.pone.0053649

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., et al. (2012). Сверхвысокопроизводительный анализ микробного сообщества на платформах Illumina HiSeq и MiSeq. ISME J. 6, 1621–1624. DOI: 10.1038 / ismej.2012.8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Чакраворти, С., Хелб, Д., Бердей, М., Коннелл, Н., и Алланд, Д.(2007). Подробный анализ сегментов гена 16S рибосомной РНК для диагностики патогенных бактерий. J. Microbiol. Методы 69, 330–339. DOI: 10.1016 / j.mimet.2007.02.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Клэссон, М. Дж., Ван, К., О’Салливан, О., Грин-Диниз, Р., Коул, Дж. Р., Росс, Р. П. и др. (2010). Сравнение двух технологий секвенирования следующего поколения для определения очень сложного состава микробиоты с использованием тандемных вариабельных участков гена 16S рРНК. Nucleic Acids Res. 38: e200. DOI: 10.1093 / nar / gkq873

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Козен, В., Ю, Г., Гейл, М. Х., Ридаура, В. К., Натвани, Б. Н., Хван, А. Е. и др. (2013). Разнообразие фекальной микробиоты у лиц, переживших лимфому Ходжкина подросткового / молодого возраста: исследование близнецов. Br. J. Cancer 108, 1163–1167. DOI: 10.1038 / bjc.2013.60

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дуин, Э.К., Вагнер, Т., Шима, С., Пракаш, Д., Кронин, Б., Янез-Руис, Д. Р. и др. (2016). Раскрыт механизм действия для специфического снижения выбросов метана от жвачных животных за счет низкомолекулярного 3-нитрооксипропанола. Proc. Natl. Акад. Sci. США 113, 6172–6177. DOI: 10.1073 / pnas.16002

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эйкмейер, Ф. Г., Радемахер, А., Ханрайх, А., Хенниг, М., Янике, С., Маус, И., и др. (2013). Детальный анализ наборов данных метагенома, полученных от микробных сообществ, производящих биогаз, проживающих в биогазовых реакторах, не указывает на присутствие предполагаемых патогенных микроорганизмов. Biotechnol. Биотопливо 6:49. DOI: 10.1186 / 1754-6834-6-49

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ewing, B., Hillier, L., Wendl, M.C., and Green, P. (1998). Базовый вызов трассировок автоматического секвенсора с использованием phred. I. Оценка точности. Genome Res. 8, 175–185. DOI: 10.1101 / gr.8.3.175

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фирер Н., Хамади М., Лаубер К. Л. и Найт Р. (2008).Влияние пола, владения руками и мытья рук на разнообразие бактерий на поверхности рук. Proc. Natl. Акад. Sci. США 105, 17994–17999. DOI: 10.1073 / pnas.0807

5

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Франциски Д., де Куджиас П. Г., Треу Л., Кампанаро С. и Ангелидаки И. (2015). Микробное разнообразие и динамичность биогазовых реакторов за счет радикальных изменений состава сырья. Биоресурсы. Technol. 176, 56–64. DOI: 10.1016 / j.biortech.2014.10.126

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Франк Д. Н., Сент-Аманд А. Л., Фельдман Р. А., Бодекер Е. К., Харпаз Н. и Пейс Н. Р. (2007). Молекулярно-филогенетическая характеристика дисбаланса микробного сообщества при воспалительных заболеваниях кишечника человека. Proc. Natl. Акад. Sci. США 104, 13780–13785. DOI: 10.1073 / pnas.0706625104

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Франк, Дж.А., Райх, К. И., Шарма, С., Вейсбаум, Дж. С., Уилсон, Б. А., и Олсен, Г. Дж. (2008). Критическая оценка двух праймеров, обычно используемых для амплификации бактериальных генов 16S рРНК. Заявл. Environ. Microbiol. 74, 2461–2470. DOI: 10.1128 / AEM.02272-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гантнер С., Андерссон А. Ф., Алонсо-Саез Л. и Бертилссон С. (2011). Новые праймеры для анализа сообществ архей на основе 16S рРНК в образцах окружающей среды. J. Microbiol. Методы 84, 12–18. DOI: 10.1016 / j.mimet.2010.10.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гилберт, Дж. А., Мейер, Ф., Янссон, Дж., Гордон, Дж., Пейс, Н., Тидже, Дж. И др. (2010). Проект «Земной микробиом»: отчет о «1 встрече EMP по отбору и сбору образцов» в аргоннской национальной лаборатории 6 октября 2010 г. Stand. Genomic Sci. 3, 249–253. DOI: 10.4056 / aigs.1443528

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гу, X., Calusinska, M., Lemaigre, S., Marynowska, M., Klocke, M., Udelhoven, T., et al. (2015). Динамика микробного сообщества в репликах анаэробных варочных котлов последовательно подвергается возрастающей скорости органической нагрузки, ацидозу и восстановлению процесса. Biotechnol. Биотопливо 8, 122. doi: 10.1186 / s13068-015-0309-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Güllert, S., Fischer, M.A., Turaev, D., Noebauer, B., Ilmberger, N., Wemheuer, B., et al. (2016). Глубокий метагеномный и метатранскриптомный анализ микробных сообществ, связанных с промышленным биогазовым ферментером, коровьим рубцом и фекалиями слонов, выявляет существенные различия в стратегиях гидролиза углеводов. Biotechnol. Биотопливо 9: 121. DOI: 10.1186 / s13068-016-0534-x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хамади, М., и Найт, Р. (2009). Профилирование микробного сообщества для проектов по микробиому человека: инструменты, методы и проблемы. Genome Res. 19, 1141–1152. DOI: 10.1101 / gr.085464.108

PubMed Аннотация | CrossRef Полный текст

Хамади, М., Уокер, Дж. Дж., Харрис, Дж. К., Голд, Н. Дж., И Найт, Р. (2008).Штрих-кодовые праймеры с исправлением ошибок для пиросеквенирования сотен образцов в мультиплексе. Nat. Методы 5, 235–237. DOI: 10.1038 / nmeth.1184

PubMed Аннотация | CrossRef Полный текст

Хендерсон, Г., Кокс, Ф., Ганеш, С., Джонкер, А., Янг, В., и Янссен, П. Х. (2015). Состав микробного сообщества рубца варьируется в зависимости от диеты и хозяина, но основной микробиом встречается в широком географическом диапазоне. Sci. Отчет 5: 14567. DOI: 10.1038 / srep14567

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Херлеманн, Д.П., Лабренц, М., Юргенс, К., Бертилссон, С., Ваниек, Дж. Дж., И Андерссон, А. Ф. (2011). Переходы в бактериальных сообществах вдоль 2000 км градиента солености Балтийского моря. ISME J. 5, 1571–1579. DOI: 10.1038 / ismej.2011.41

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hiergeist, A., Reischl, U., and Gessner, A. (2016). Многоцентровая оценка качества секвенирования 16S рибосомальной ДНК для анализа микробиома показывает высокую межцентровую изменчивость. Int. J. Med. Microbiol. DOI: 10.1016 / j.ijmm.2016.03.005. [Epub перед печатью].

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ининбергс, К., Бергман, Б., Ларссон, Дж., И Экман, М. (2015). Микробная метагеномика в Балтийском море: последние достижения и перспективы экологического мониторинга. Ambio 44 (Дополнение 3), 439–450. DOI: 10.1007 / s13280-015-0663-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Джеанатан, Дж., Кирс, М., Ронимус, Р. С., Хоскин, С. О., и Янссен, П. Х. (2011). Структура сообщества метаногена в рубцах разводимых овец, крупного рогатого скота и благородных оленей, получавших разный рацион. FEMS Microbiol. Ecol. 76, 311–326. DOI: 10.1111 / j.1574-6941.2011.01056.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Йост, Л., Де Вриз, П., Валла, Т., Грин, Х., Чао, А. и Рикотта, К. (2010). Разбиение разнообразия на разделы для анализа сохранения. Дайверы. Дистриб. 16, 65–76.DOI: 10.1111 / j.1472-4642.2009.00626.x

CrossRef Полный текст | Google Scholar

Ким, М., Моррисон, М., Ю З. (2011). Оценка различных участков последовательности гена частичной 16S рРНК для филогенетического анализа микробиомов. J. Microbiol. Методы 84, 81–87. DOI: 10.1016 / j.mimet.2010.10.020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Киттельманн, С., Зеедорф, Х., Уолтерс, В.А., Клементе, Дж. К., Найт, Р., Гордон, Дж.I., et al. (2013). Одновременное секвенирование ампликонов для изучения моделей совместного присутствия бактериальных, архейных и эукариотических микроорганизмов в микробных сообществах рубца. PLoS ONE 8: e47879. DOI: 10.1371 / journal.pone.0047879

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Клиндворт, А., Прюсс, Э., Швир, Т., Пеплис, Дж., Кваст, К., Хорн, М. и др. (2013). Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований и исследований разнообразия на основе секвенирования следующего поколения. Nucleic Acids Res. 41, е1. DOI: 10.1093 / nar / gks808

PubMed Аннотация | CrossRef Полный текст

Козич, Дж. Дж., Весткотт, С. Л., Бакстер, Н. Т., Хайлендер, С. К., и Шлосс, П. Д. (2013). Разработка стратегии двухиндексного секвенирования и конвейера курации для анализа данных последовательности ампликонов на платформе секвенирования MiSeq Illumina. Заявл. Environ. Microbiol. 79, 5112–5120. DOI: 10.1128 / AEM.01043-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

ЛаМонтань, М.Г., Мишель, Ф. К., Холден, П. А., и Редди, К. А. (2002). Оценка методов экстракции и очистки для получения ПЦР-амплифицируемой ДНК из компоста для анализа микробного сообщества. J. Microbiol. Методы 49, 255–264. DOI: 10.1016 / S0167-7012 (01) 00377-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лейн, Д. Дж., Пейс, Б., Олсен, Г. Дж., Шталь, Д. А., Согин, М. Л., и Пейс, Н. Р. (1985). Быстрое определение последовательностей рибосомальной РНК 16S для филогенетических анализов. Proc. Natl. Акад. Sci. USA 82, 6955–6959.

PubMed Аннотация | Google Scholar

Лангфельдт, Д., Нойлингер, С. К., Хойер, В., Штауфенбиль, И., Кюнцель, С., Бейнс, Дж. Ф. и др. (2014). Состав микробных биопленок полости рта во время созревания у молодых здоровых взрослых. PLoS ONE 9: e87449. DOI: 10.1371 / journal.pone.0087449

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ли, К., Ким, Дж., Шин, С. Г., и Хван, С.(2008). Мониторинг изменений бактериального и архейного сообществ в мезофильном анаэробном реакторе периодического действия, обрабатывающем сточные воды с высоким содержанием органических веществ. FEMS Microbiol. Ecol. 65, 544–554. DOI: 10.1111 / j.1574-6941.2008.00530.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лежандр П. и Галлахер Э. (2001). Экологически значимые преобразования для упорядочивания данных по видам. Oecologia 129, 271–280. DOI: 10.1007 / s004420100716

CrossRef Полный текст | Google Scholar

Лежандр, П., и Лежандр, Л. (1998). Числовая экология, 2-е английское издание . Амстердам, Нью-Йорк: Эльзевир.

Leininger, S., Urich, T., Schloter, M., Schwark, L., Qi, J., Nicol, G.W., et al. (2006). Среди прокариот, окисляющих аммиак, преобладают археи. Природа 442, 806–809. DOI: 10.1038 / nature04983

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лимам Р. Д., Чуари Р., Мазеас Л., Ву Т.-Д., Ли Т., Гроссин-Дебаттиста Дж. И др.(2014). Члены некультивируемого бактериального подразделения-кандидата WWE1 участвуют в анаэробном переваривании целлюлозы. Microbiologyopen 3, 157–167. DOI: 10.1002 / mbo3.144

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Логарес, Р., Сунагава, С., Салазар, Г., Корнехо-Кастильо, Ф. М., Феррера, И., Сарменто, Х. и др. (2014). Метагеномные метки 16S рДНК Illumina — мощная альтернатива секвенированию ампликонов для изучения разнообразия и структуры микробных сообществ. Environ. Microbiol. 16, 2659–2671. DOI: 10.1111 / 1462-2920.12250

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Луо, К., Цеменци, Д., Кирпидес, Н., Рид, Т., и Константинидис, К. Т. (2012). Прямое сравнение технологий секвенирования Illumina и Roche 454 на одном и том же образце ДНК микробного сообщества. PLoS ONE 7: e30087. DOI: 10.1371 / journal.pone.0030087

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Менш, Б., Нойлингер, С.С., Графф, А., Панш, А., Кюнцель, С., Фишер, М.А., и др. (2016). Реструктуризация эпибактериальных сообществ на Fucus vesiculosus forma mytili в ответ на повышенный pCO2 и повышенный уровень температуры. Фронт. Microbiol. 7: 434. DOI: 10.3389 / fmicb.2016.00434

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Моралес, С. Э., и Холбен, В. Э. (2009). Эмпирическое тестирование пар праймеров для ПЦР гена 16S рРНК выявило различия в целевой специфичности и эффективности, не предполагаемые анализом in silico . Заявл. Environ. Microbiol. 75, 2677–2683. DOI: 10.1128 / AEM.02166-08

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Неттманн, Э., Бергманн, И., Мундт, К., Линке, Б., и Клок, М. (2008). Разнообразие архей на коммерческой биогазовой установке, использующей травяную биомассу, определено с помощью анализа 16S рДНК и mcrA. J. Appl. Microbiol. 105, 1835–1850. DOI: 10.1111 / j.1365-2672.2008.03949.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Огава, Д.М. О., Мория, С., Цубои, Ю., Дате, Ю., Прието-да-Силва, А. Р. Б., Радис-Баптиста, Г. и др. (2014). Биогеохимическое типирование рисовых полей с помощью подхода, основанного на данных, выявляющего подсистемы в сложной среде — конвейер для фильтрации, организации и формирования массивных наборов данных на основе многокомпонентного анализа. PLoS ONE 9: e110723. DOI: 10.1371 / journal.pone.0110723

PubMed Аннотация | CrossRef Полный текст | Google Scholar

О, Дж., Берд, А. Л., Деминг, К., Конлан, С., Конг, Х.Х., Сегре Дж. А. (2014). Биогеография и функция формы индивидуальности в метагеноме кожи человека. Природа 514, 59–64. DOI: 10.1038 / природа13786

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Оксанен, Дж., Бланше, Ф. Г., Киндт, Р., Лежандр, П., Минчин, П. Р., О’хара, Р. Б. и др. (2015). Vegan: пакет Community Ecology, пакет R версии 2.3-0. Доступно в Интернете по адресу: https://cran.r-project.org/web/packages/vegan/

Парк, С.-Дж., Парк Б.-Дж. и Ри С.-К. (2008). Сравнительный анализ генов 16S рРНК и amoA архей для оценки численности и разнообразия архей, окисляющих аммиак, в морских отложениях. Экстремофилы 12, 605–615. DOI: 10.1007 / s00792-008-0165-7

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пол К., Нонох Дж. О., Микульски Л. и Брун А. (2012). «Methanoplasmatales», археи, связанные с Thermoplasmatales, в кишечнике термитов и других средах, являются седьмым порядком метаногенов. Заявл. Environ. Microbiol. 78, 8245–8253. DOI: 10.1128 / AEM.02193-12

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Pelletier, E., Kreimeyer, A., Bocs, S., Rouy, Z., Gyapay, G., Chouari, R., et al. (2008). «Candidatus Cloacamonas acidaminovorans»: реконструкция последовательности генома дает первое представление о новом бактериальном делении. J. Bacteriol. 190, 2572–2579. DOI: 10.1128 / JB.01248-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Петерсон, Дж., Гарджес, С., Джованни, М., Макиннес, П., Ван, Л., Шлосс, Дж. А. и др. (2009). Проект NIH по микробиому человека. Genome Res. 19, 2317–2323. DOI: 10.1101 / gr.0

.109

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Pruesse, E., Quast, C., Knittel, K., Fuchs, B.M., Ludwig, W., Peplies, J., et al. (2007). SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Res. 35, 7188–7196. DOI: 10.1093 / nar / gkm864

PubMed Аннотация | CrossRef Полный текст | Google Scholar

R Основная команда (2015). R: язык и среда для статистических вычислений . Австрия: статистические вычисления.

Rausch, P., Rehman, A., Künzel, S., Häsler, R., Ott, S.J., Schreiber, S., et al. (2011). На микробиоту слизистой оболочки толстой кишки влияет взаимодействие болезни Крона и генотипа FUT2 (Secretor). Proc. Natl. Акад.Sci. США 108, 19030–19035. DOI: 10.1073 / pnas.1106408108

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Reysenbach, A.-L., Liu, Y., Banta, A. B., Beveridge, T. J., Kirshtein, J. D., Schouten, S., et al. (2006). Вездесущий термоацидофильный архей из глубоководных гидротермальных источников. Природа 442, 444–447. DOI: 10.1038 / nature04921

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ripple, W. J., Smith, P., Haberl, H., Montzka, S.A., McAlpine, C., и Boucher, D.H. (2014). Жвачные животные, изменение климата и климатическая политика. Nat. Клим. Изменить 4, 2–5. DOI: 10.1038 / nclimate2081

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шлосс, П. Д., Геверс, Д., Весткотт, С. Л., и Гилберт, Дж. А. (2011). Снижение влияния артефактов амплификации ПЦР и секвенирования на исследования на основе 16S рРНК. PLoS ONE 6: e27310. DOI: 10.1371 / journal.pone.0027310

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Schloss, P.Д., Весткотт, С. Л., Рябин, Т., Холл, Дж. Р., Хартманн, М., Холлистер, Э. Б. и др. (2009). Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом для описания и сравнения сообществ микробов. Заявл. Environ. Microbiol. 75, 7537–7541. DOI: 10.1128 / AEM.01541-09

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Шакья, М., Айва, К., Кэмпбелл, Дж. Х., Янг, З. К., Шадт, К. В., и Подар, М. (2013). Сравнительная характеристика метагеномного и микробного разнообразия рРНК с использованием синтетических сообществ архей и бактерий. Environ. Microbiol. 15, 1882–1899. DOI: 10.1111 / 1462-2920.12086

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ши, В., Мун, К. Д., Лихи, С. К., Канг, Д., Фрула, Дж., Киттельманн, С., и др. (2014). Фенотипы выхода метана связаны с дифференциальной экспрессией генов в микробиоме рубца овец. Genome Res. 24, 1517–1525. DOI: 10.1101 / gr.168245.113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сингх К.М., Трипати, А. К., Пандья, П. Р., Парнеркар, С., Ранк, Д. Н., Котари, Р. К. и др. (2012). Разнообразие метаногена в рубце индийского буйвола Сурти ( Bubalus bubalis ), оцененное с помощью анализа 16S рДНК. Res. Вет. Sci. 92, 451–455. DOI: 10.1016 / j.rvsc.2011.03.022

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Скиллман, Л. К., Эванс, П. Н., Нейлор, Г. Э., Морван, Б., Джарвис, Г. Н., и Джоблин, К. Н. (2004). 16S рибосомные ДНК-направленные праймеры для ПЦР метаногенов рубца и идентификация метаногенов, колонизирующих молодых ягнят. Анаэроб 10, 277–285. DOI: 10.1016 / j.anaerobe.2004.05.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Солли, Л., Хавелсруд, О. Э., Хорн, С. Дж., И Рике, А. Г. (2014). Метагеномное исследование микробных сообществ в четырех параллельных биогазовых реакторах. Biotechnol. Биотопливо 7, 146. doi: 10.1186 / s13068-014-0146-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Зёллингер, А., Шваб, К., Вайнмайер, Т., Loy, A., Tveit, A. T., Schleper, C., et al. (2016). Филогенетический и геномный анализ Methanomassiliicoccales на водно-болотных угодьях и в кишечных трактах животных выявил предпочтения среды обитания, характерные для клады. FEMS Microbiol. Ecol. 92: fiv149. DOI: 10.1093 / фемсек / fiv149

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Sundberg, C., Al-Soud, W. A., Larsson, M., Alm, E., Yekta, S. S., Svensson, B.H., et al. (2013). 454 пиросеквенирования анализа бактериального и архейного богатства в 21 полномасштабном биогазовом варочном котле. FEMS Microbiol. Ecol. 85, 612–626. DOI: 10.1111 / 1574-6941.12148

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Такай К. и Хорикоши К. (2000). Быстрое обнаружение и количественная оценка членов сообщества архей с помощью количественной ПЦР с использованием флуорогенных зондов. Заявл. Environ. Microbiol. 66, 5066–5072. DOI: 10.1128 / AEM.66.11.5066-5072.2000

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Такай, К., и Накамура, К. (2011). Разнообразие архей и развитие сообществ в глубоководных гидротермальных жерлах. Curr. Opin. Microbiol. 14, 282–291. DOI: 10.1016 / j.mib.2011.04.013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Tremblay, J., Singh, K., Fern, A., Kirton, E. S., He, S., Woyke, T., et al. (2015). Влияние праймера и платформы на секвенирование метки 16S рРНК. Фронт. Microbiol. 6: 771. DOI: 10.3389 / fmicb.2015.00771

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тернбо, П.Дж., Лей, Р. Э., Хамади, М., Фрейзер-Лиггетт, К. М., Найт, Р., и Гордон, Дж. И. (2007). Проект микробиома человека. Природа 449, 804–810. DOI: 10.1038 / nature06244

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Тайменсен, Л. Д., и Макаллистер, Т. А. (2012). Анализ структуры сообщества метаногенов, связанных с простейшими в рубце, выявляет предвзятость универсальных праймеров для архей. Заявл. Environ. Microbiol. 78, 4051–4056. DOI: 10.1128 / AEM.07994-11

PubMed Аннотация | CrossRef Полный текст | Google Scholar

van Bleijswijk, J. D. L., Whalen, C., Duineveld, G. C. A., Lavaleye, M. S. S., Witte, H. J., and Mienis, F. (2015). Сообщества микробов на холме холодноводных кораллов на берегу SE Rockall Bank (северо-восточная Атлантика): взаимодействие с гидрографией и топографией. Biogeosci. Обсуждать. 12, 1509–1542. DOI: 10.5194 / bgd-12-1509-2015

CrossRef Полный текст | Google Scholar

Vanwonterghem, I., Дженсен, П. Д., Хо, Д. П., Батстон, Д. Дж., И Тайсон, Г. У. (2014). Связывание структуры, взаимодействий и функций микробного сообщества в анаэробных варочных котлах с использованием новых молекулярных методов. Curr. Opin. Biotechnol. 27, 55–64. DOI: 10.1016 / j.copbio.2013.11.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вентер, Дж. К., Ремингтон, К., Гейдельберг, Дж. Ф., Халперн, А. Л., Руш, Д., Эйзен, Дж. А. и др. (2004). Секвенирование экологического генома Саргассова моря. Наука 304, 66–74. DOI: 10.1126 / science.10

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wang, J., Kalyan, S., Steck, N., Turner, L.M., Harr, B., Kunzel, S., et al. (2015). Анализ кишечной микробиоты гибридных домовых мышей показывает эволюционное расхождение в гологеноме позвоночных. Nat. Commun. 6: 6440. DOI: 10.1038 / ncomms7440

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ватанабэ, Т., Асакава, С., Накамура, А., Нагаока, К., и Кимура, М. (2004). Метод DGGE для анализа 16S рДНК метаногенного сообщества архей в почве рисовых полей. FEMS Microbiol. Lett. 232, 153–163. DOI: 10.1016 / S0378-1097 (04) 00045-X

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вейланд, Н., Лёшер, К., Мецгер, Р., и Шмитц, Р. (2010). Создание и проверка морских метагеномных библиотек. Methods Mol. Биол. 668, 51–65. DOI: 10.1007 / 978-1-60761-823-2_3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вейланд-Бройер, Н., Нойлингер, С. К., Пиннов, Н., Кюнцель, С., Бейнс, Дж. Ф., и Шмитц, Р. А. (2015). Состав бактериальных сообществ, связанных с Aurelia aurita , меняется в зависимости от компартмента, стадии жизни и популяции. Заявл. Environ. Microbiol. 81, 6038–6052. DOI: 10.1128 / AEM.01601-15

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вернер, Дж.Дж., Корен, О., Гугенгольц, П., ДеСантис, Т. З., Уолтерс, В. А., Капорасо, Дж. Г. и др. (2012). Влияние обучающих наборов на классификацию высокопроизводительных исследований генов бактериальной 16s рРНК. ISME J. 6, 94–103. DOI: 10.1038 / ismej.2011.82

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вирт, Р., Ковач, Э., Мароти, Г., Баги, З., Ракхели, Г., и Ковач, К. Л. (2012). Характеристика микробного сообщества, производящего биогаз, путем короткого секвенирования ДНК следующего поколения. Biotechnol. Биотопливо 5:41. DOI: 10.1186 / 1754-6834-5-41

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вёзе, К. Р., Фокс, Г. Э. (1977). Филогенетическая структура прокариотического домена: первичные царства. Proc. Natl. Акад. Sci. США 74, 5088–5090. DOI: 10.1073 / pnas.74.11.5088

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вёзе, К. Р., Кандлер, О., и Вилис, М. Л. (1990). К естественной системе организмов: предложение о доменах архей, бактерий и эукариев. Proc. Natl. Акад. Sci. США 87, 4576–4579. DOI: 10.1073 / pnas.87.12.4576

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Wuebbles, D. (2002). Атмосферный метан и глобальные изменения. Науки о Земле. Ред. 57, 177–210. DOI: 10.1016 / S0012-8252 (01) 00062-9

CrossRef Полный текст | Google Scholar

Yu, Y., Lee, C., Kim, J., and Hwang, S. (2005). Группоспецифичные наборы праймеров и зондов для обнаружения метаногенных сообществ с использованием количественной полимеразной цепной реакции в реальном времени. Biotechnol. Bioeng. 89, 670–679. DOI: 10.1002 / bit.20347

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ю. З., Гарсиа-Гонсалес Р., Шанбахер Ф. Л. и Моррисон М. (2008). Оценка различных гипервариабельных участков генов 16S рРНК архей при профилировании метаногенов с помощью специфической для архей ПЦР и денатурирующего градиентного гель-электрофореза. Заявл. Environ. Microbiol. 74, 889–893. DOI: 10.1128 / AEM.00684-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Юсуф Р.О., Нур, З. З., Абба, А. Х., Хассан, М. А. А., и Дин, М. Ф. М. (2012). Выбросы метана по секторам: всесторонний обзор источников выбросов и методов снижения. Возобновляемые источники энергии. Energy Rev. 16, 5059–5070. DOI: 10.1016 / j.rser.2012.04.008

CrossRef Полный текст | Google Scholar

Выбор подтвержденных гипервариабельных участков имеет решающее значение в исследованиях микробиоты женских половых путей на основе 16S.

  • 1.

    Ravel, J. et al. . Микробиом влагалища женщин репродуктивного возраста. Proc Natl Acad Sci USA 108 , 4680–4687 (2011).

    ADS
    Статья
    PubMed

    Google Scholar

  • 2.

    Нанн, К. Л. и др. . Повышенное улавливание ВИЧ-1 цервиковагинальной слизью человека связано с доминирующей микробиотой Lactobacillus crispatus. MBio 6 , e01084–01015, https://doi.org/10.1128/mBio.01084-15 (2015).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 3.

    Gajer, P. et al. . Временная динамика вагинальной микробиоты человека. Sci Transl Med 4 , 132–152 (2012).

    Артикул

    Google Scholar

  • 4.

    van Houdt, R. et al. . Микробиота влагалища с преобладанием Lactobacillus iners связана с повышенной восприимчивостью к инфекции Chlamydia trachomatis у голландских женщин: исследование случай-контроль. Заражение, передаваемое половым путем 94 , 117–123, https: // doi.org / 10.1136 / sextrans-2017-053133 (2018).

    PubMed
    Статья

    Google Scholar

  • 5.

    Nardini, P. et al. . Lactobacillus crispatus подавляет инфекционность элементарных тел Chlamydia trachomatis, исследование in vitro, . Sci Rep 6 , 29024, https://doi.org/10.1038/srep29024 (2016).

    ADS
    Статья
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 6.

    van der Veer, C., Bruisten, SM, van der Helm, JJ, de Vries, HJ & van Houdt, R. Цервиковагинальная микробиота у женщин, зарегистрированных на инфекцию Chlamydia trachomatis: исследование случай-контроль в амбулаторных условиях с инфекциями, передающимися половым путем Клиника в Амстердаме, Нидерланды. Clin Infect Dis 64 , 24–31, https://doi.org/10.1093/cid/ciw586 (2017).

    Артикул
    PubMed

    Google Scholar

  • 7.

    Graspeuntner, S. et al. . Анализ микробиоты выявляет специфические бактериальные признаки и новую стратегию диагностики инфекционного бесплодия. PLoS One 13 , e01

    , https://doi.org/10.1371/journal.pone.01

    (2018).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 8.

    Loeper, N., Graspeuntner, S. & Rupp, J. Изменения микробиоты влияют на инфекции, передаваемые половым путем, и развитие воспалительных заболеваний органов малого таза. Microbes Infect , https://doi.org/10.1016/j.micinf.2018.02.003 (2018).

  • 9.

    Шипицына Е. и др. . Возможен ли состав микробиоты влагалища у женщин репродуктивного возраста — возможна ли специфическая молекулярная диагностика бактериального вагиноза? PLoS One 8 , e60670, https://doi.org/10.1371/journal.pone.0060670 (2013).

    ADS
    Статья
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 10.

    Meisel, J. et al. . Исследования микробиома кожи сильно зависят от дизайна экспериментов. Журнал следственной дерматологии 136 , 947–956 (2016).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 11.

    Корен, О. и др. . Микробиота ротовой полости, кишечника и зубного налета человека у пациентов с атеросклерозом. Proc Natl Acad Sci USA 108 , 4592–4598 (2011).

    ADS
    Статья
    PubMed

    Google Scholar

  • 12.

    Альбертсен М., Карст С. М., Циглер А. С., Киркегаард Р. Х. и Нильсен П. Х. Назад к основам — Влияние экстракции ДНК и выбора праймера на филогенетический анализ сообществ активированного ила. PLoS One 10 (2015).

  • 13.

    Робинсон, К. К., Бротман, Р. М. и Равель, Дж. Тонкости оценки микробиома человека в эпидемиологических исследованиях. Ann Epidemiol 26 , 311–321, https://doi.org/10.1016/j.annepidem.2016.04.005 (2016).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 14.

    Франк, Дж. А. и др. . Критическая оценка двух праймеров, обычно используемых для амплификации бактериальных генов 16S рРНК. Appl Environ Microbiol 74 , 2461–2470, https://doi.org/10.1128/AEM.02272-07 (2008).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 15.

    Феттвейс, Дж. М. и др. . Классификация микробиома влагалища на уровне видов. BMC Genomics (2012).

  • 16.

    Cai, L., Ye, L., Tong, A.H., Lok, S. & Zhang, T. Смещенные показатели разнообразия, выявленные бактериальными пиротагами 16S, полученными из различных наборов праймеров. PLoS One 8 , e53649, https://doi.org/10.1371/journal.pone.0053649 (2013).

    ADS
    Статья
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 17.

    Клиндворт, А. и др. . Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований и исследований разнообразия на основе секвенирования следующего поколения. Nucleic Acids Res 41 , e1, https://doi.org/10.1093/nar/gks808 (2013).

    Артикул
    PubMed
    CAS

    Google Scholar

  • 18.

    Ламонт, Р. Ф. и др. . Микробиом влагалища: новая информация о флоре половых путей с использованием молекулярных методов. BJOG: международный журнал по акушерству и гинекологии 118 , 533–549, https://doi.org/10.1111/j.1471-0528.2010.02840.x (2011).

    Артикул
    CAS

    Google Scholar

  • 19.

    Ghartey, J. P. et al. . Доминирующий вагинальный микробиом Lactobacillus crispatus связан с ингибирующей активностью секреции женских половых путей в отношении Escherichia coli . PLoS One 9 , e

    , https: // doi.org / 10.1371 / journal.pone.00

    (2014).

    ADS
    Статья
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 20.

    Каллахан, Б. Дж. и др. . Репликация и уточнение вагинальной микробной сигнатуры преждевременных родов в двух расово разных когортах женщин США. Proc Natl Acad Sci USA , https://doi.org/10.1073/pnas.1705899114 (2017).

  • 21.

    Ikonomidis, A. et al. .Распространенность Chlamydia trachomatis, Ureaplasma spp., Mycoplasma genitalium и Mycoplasma hominis среди амбулаторных пациентов в центральной Греции: отсутствие гена устойчивости к тетрациклину tet (M) в течение 4-летнего исследования. Новые микробы. Новое заражение. 9 , 8–10, https://doi.org/10.1016/j.nmni.2015.11.005 (2016).

    Артикул
    PubMed
    CAS

    Google Scholar

  • 22.

    Brotman, R.M. и др. . Связь между курением сигарет и микробиотой влагалища: пилотное исследование. BMC Infect Dis 14 , 471, https://doi.org/10.1186/1471-2334-14-471 (2014).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 23.

    Zeeuwen, P. L. et al. . Ответ на Meisel et al . Журнал исследовательской дерматологии 137 , 961–962, https://doi.org/10.1016/j.jid.2016.11.013 (2017).

    Артикул
    PubMed
    CAS

    Google Scholar

  • 24.

    Kalle, E., Kubista, M. & Rensing, C. Мультиматричная полимеразная цепная реакция. Biomol Detect Quantif 2 , 11–22 (2014).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 25.

    Козич, Дж. Дж., Весткотт, С. Л., Бакстер, Н. Т., Хайлендер, С. К. и Шлосс, П. Д. Разработка стратегии двухиндексного секвенирования и конвейера курирования для анализа данных последовательностей ампликонов на платформе секвенирования MiSeq Illumina. Appl Environ Microbiol 79 , 5112–5120, https://doi.org/10.1128/AEM.01043-13 (2013).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 26.

    Fadrosh, D. W. et al. . Улучшенный подход двойной индексации для мультиплексного секвенирования гена 16S рРНК на платформе Illumina MiSeq. Microbiome 2 , 6, https://doi.org/10.1186/2049-2618-2-6 (2014).

    Артикул
    PubMed
    PubMed Central

    Google Scholar

  • 27.

    Шлосс, П. Д. и др. . Представляем mothur: программное обеспечение с открытым исходным кодом, независимое от платформы, поддерживаемое сообществом для описания и сравнения сообществ микробов. Appl Environ Microbiol 75 , 7537–7541, https://doi.org/10.1128/AEM.01541-09 (2009).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 28.

    Giles, D. A. et al. . Термонейтральное жилье обостряет неалкогольную жировую болезнь печени у мышей и позволяет моделировать заболевание независимо от пола. Nat Med 23 , 829–838, https://doi.org/10.1038/nm.4346 (2017).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 29.

    Pruesse, E. et al. . SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Research 35 , 7188–7196 (2007).

    Google Scholar

  • 30.

    Эдгар, Р. К., Хаас, Б. Дж., Клементе, Дж. К., Айва, К. и Найт, Р. UCHIME улучшает чувствительность и скорость обнаружения химер. Биоинформатика 27 , 2194–2200 (2011).

    Артикул
    PubMed
    PubMed Central
    CAS

    Google Scholar

  • 31.

    R Основная группа. R: Язык и среда для статистических вычислений. R Фонд статистических вычислений , Вена , Австрия .https://www.R-project.org/ (2015).

  • 32.

    Оксанен, Дж. и др. . веганский: Пакет «Экология сообщества». R версия пакета 2 . 3-2 . http://CRAN.R-project.org/package=vegan (2015).

  • 33.

    Бутрос, П. К. Бутрос Lab.plotting.general: Функции для создания графиков качества публикации. R версия пакета 5 . 3 ,4 (2015).

  • 34.

    Абель, Г. Дж. Мигест: методы косвенной оценки двусторонней миграции. R версия пакета 1 . 7 . 3 http://CRAN.R-projekt.org/package=migest (2016).

  • 35.

    Gu, Z., Gu, L., Eils, R., Schlesner, M. & Brors, B. circlize Реализует и улучшает круговую визуализацию в R. Bioinformatics 30 , 2811–2812, https://doi.org/10.1093/bioinformatics/btu393 (2014).

    Артикул
    PubMed
    CAS

    Google Scholar

  • 36.

    Де Касерес, М.& Лежандр, П. Ассоциации между видами и группами участков: индексы и статистический вывод. Экология 90 , 3566–3574 (2009).

    Артикул
    PubMed

    Google Scholar

  • 37.

    Менар, Дж. П., Феноллар, Ф., Генри, М., Бретель, Ф. и Рауль, Д. Молекулярная количественная оценка нагрузки Gardnerella vaginalis и Atopobium vaginae для прогнозирования бактериального вагиноза. Clin Infect Dis 47 , 33–43, https: // doi.org / 10.1086 / 588661 (2008).

    Артикул
    PubMed
    CAS

    Google Scholar

  • Определение свойств олигонуклеотидов и конструирование праймеров: критический анализ прогнозов | Биоинформатика

    Аннотация

    Мотивация: Точное предсказание температуры плавления ( T m ), вторичные структуры и дизайн олигонуклеотидов определяют эффективность и успех экспериментов в молекулярной биологии.Доступность множества программного обеспечения и неосведомленность пользователей об их ограничениях ставят под угрозу точность и надежность прогнозов.

    Результаты: Был проведен сравнительный анализ 56 модулей для предсказания T m с использованием большого набора олигонуклеотидных последовательностей, охватывающих весь диапазон GC-содержания и длины. Модуль Allawi калькулятора MELTING, Nearest Neighbor (NN) oligo Calculator (McLab), NN T m Расчет для Oligos (Biomath Calculator, Promega) и HYTHER предоставил наиболее точные T m предсказания.Также была предложена модель для расчета оптимальной температуры отжига, объединяющая уже описанные составы. Предсказания вторичной структуры олигонуклеотидов показывают большое количество структур в отличие от экспериментальных наблюдений. Из 11 оцененных инструментов для создания праймеров Primer 3 и WebPrimer показали наилучшие результаты для шаблонов с расширенным набором AT, Exon Primer для шаблонов AT = GC, а также Primer Design Assistant, Primer3 и Primer Quest для шаблонов с расширенным набором данных. Это исследование предоставляет пользователю оптимальный выбор приложения, повышая успешность различных экспериментов, особенно тех, которые имеют высокопроизводительный и сложный дизайн.

    Контакт: [email protected]

    Дополнительная информация: Подробная информация об олигонуклеотидах и различных модулях прогноза T m , рассматриваемых для исследования, представлена ​​в качестве дополнительной информации, доступной по адресу Биоинформатика онлайн.

    ВВЕДЕНИЕ

    Эксперименты в области молекулярной биологии неизменно вращаются вокруг олигонуклеотидов, группы дезоксинуклеотидов. Некоторые из методов, в которых олигонуклеотиды используются в качестве основного компонента, включают полимеразную цепную реакцию (ПЦР), гибридизацию, блоттинг по Саузерну, секвенирование и т. Д.Пожалуй, наиболее универсальный метод, используемый сегодня, — это ПЦР, с приложениями, включающими амплификацию, клонирование, обнаружение мутаций, мутагенез и исследования полиморфизма длины рестрикционных фрагментов. Основными характеристиками олигонуклеотидов, определяющими эффективность и точность этих экспериментов, являются температура плавления ( T m ), вторичные структуры и конструкция праймера. Выбор неоптимальной последовательности или температуры может привести к амплификации или обнаружению неправильных последовательностей.Эти характерные особенности олигонуклеотидов приобретают гораздо большее значение, когда мы выбираем дизайн с высокой пропускной способностью и сложные анализы, такие как микроматрица ДНК и мультиплексная ПЦР, которые имеют много взаимодействующих олигонуклеотидов, поскольку стоимость каждой реакции огромна.

    Несколько программ доступны как коммерчески, так и бесплатно в Интернете для определения свойств олигонуклеотидов и конструирования праймеров. Для теоретической оценки T m олигонуклеотидов доступно большое количество компьютерного программного обеспечения, основанного на различных методах с учетом большого разнообразия параметров; число постоянно увеличивается.Методологии, принятые в программном обеспечении, можно в целом разделить на базовые, которые учитывают% содержания G + C для расчета T м (Marmur and Doty, 1962) (Wallace et al ., 1979), с поправкой на соли (SA ), который учитывает концентрацию соли (обычно концентрацию Na + ) (Howley et al ., 1979) и модули Nearest Neighbor (NN), которые вычисляют T m с использованием известных параметров ДНК NN. с учетом концентраций соли и олигонуклеотидов (Breslauer et al ., 1986; Freier и др. , 1986; Сугимото и др. , 1995, 1996; SantaLucia и др. , 1996; Аллави и Санта Лючия, 1997 год; Санта-Люсия, 1998 г .; Xia и др. ., 1998). T m оценка с помощью различного программного обеспечения приводит к огромным и значительным различиям, заставляя пользователей сомневаться в достоверности оценок. Помимо этого, похоже, что большинство пользователей не знают об ограничениях используемого ими программного обеспечения и методах, которые оно использует, что еще больше снижает точность и надежность.

    Другим параметром первостепенной важности, который рассматривается для качественной оценки олигонуклеотида, является образование вторичных структур, которые включают самодимеры, шпильки и кросс-димеры с другими взаимодействующими олигонуклеотидами. Доказано, что эта характеристика нуклеиновых кислот влияет на связывание олигонуклеотидов (Gamper et al. , 1987). Прогнозирование вторичной структуры для любой данной последовательности основывается на алгоритмах минимизации энергии, и вероятность правильных прогнозов весьма мала из-за ограничений математической модели и неопределенностей термодинамических параметров, используемых в этих методах (Dong et al ., 2001). Вторичная структура целевой ДНК, с которой связывается олигонуклеотид, также вызывает беспокойство (Федорова и др. ., 1992) и требует должного внимания.

    Дизайн праймера принципиально важен для всех исследований и методов обнаружения, основанных на ПЦР. Несмотря на то, что на протяжении многих лет было проведено множество исследований по разработке праймеров, полное понимание различных факторов, влияющих на амплификацию и выход продукта, все еще отсутствует. Следовательно, всегда желательно учитывать все известные параметры (Робертсон и Уолш-Веллер, 1998) и иметь программное обеспечение, которое использует этот комплексный подход, чтобы предоставить нам наилучшую возможную пару праймеров для амплификации целевой ДНК.Значительное количество неудачных попыток амплификации можно объяснить неправильным дизайном праймеров, что требует определения лучшего программного обеспечения для конструирования праймеров среди имеющихся.

    Это исследование разделено на три части: во-первых, определение лучшего калькулятора свойств олигонуклеотидов, который мог бы прогнозировать T m с наименьшим отклонением, который можно было бы использовать при вычислении оптимальной температуры отжига для амплификаций ПЦР; во-вторых, оценка прогнозов вторичной структуры; и, в-третьих, проверка эффективности программного обеспечения для разработки праймеров и определение лучшего из них.

    МЕТОДЫ

    Исследования термической плавки

    Используемые олигонуклеотиды были либо получены от Sigma Genosys, либо синтезированы на месте (в Центре геномных приложений) на высокопроизводительном синтезаторе ДНК Applied Biosystems 3900 с использованием стандартной химии фосфорамидита (Caruthers, 1982). С цепей снимали защиту, очищали, обессоливали и сушили в вакууме на концентраторе Speed ​​Vac и хранили при -20 ° C. Концентрации цепей определяли с использованием коэффициентов экстинкции при 260 нм, оцененных методом NN (Cantor et al ., 1970). Чистота и точность образцов были подтверждены масс-спектрометрическим анализом MALDI-TOF на Sequenom (Sequenom Inc., Сан-Диего, Калифорния). Олигонуклеотиды были разработаны и синтезированы таким образом, что шесть были богаты АТ (содержание GC <45%), шесть имели равные пропорции AT и GC (содержание GC 45-55%), а шесть были богаты GC (GC -содержание> 55%).

    Эксперименты по оптическому плавлению проводили на УФ-видимом спектрофотометре Cary 400 BIO (Varian Inc., Пало-Альто, Калифорния) для определения температуры плавления этих олигонуклеотидов.Образцы повторно гидратировали в буфере для плавления (10 мМ фосфат натрия, pH 8,3, содержащий 20 мМ NaCl, в результате чего общее количество [Na + ] составляло 50 мМ. Профиль поглощения в зависимости от температуры измеряли при 260 нм со скоростью нагрева 1 ° C. Для каждого образца были получены по крайней мере три полные кривые перехода.Конденсации воды на внешней стороне кюветы в низком диапазоне температур удалось избежать за счет продувки постоянным потоком сухого газа N 2 . T m Значения были рассчитывается с использованием первых производных кривых плавления.Из 90 других олигонуклеотидов, рассмотренных для исследования, 30 были получены из работы Owczarzy et al . (1997) и 60 из отчета Owczarzy et al . (2004). В последнем случае было определено T m для каждого олигонуклеотида при различных концентрациях Na + ([Na + ]), 69 мМ, 119 мМ, 220 мМ, 621 мМ и 1020 мМ.

    T м прогнозов

    После тщательного поиска во всемирной паутине было отобрано 25 бесплатных калькуляторов свойств олигонуклеотидов.Прогнозирование T m было также выполнено с использованием DNASTAR (доступен у нас) и модуля T m calc системы GeneAmp-PCR 9700 (Applied Biosystems, Foster City, CA). T m было предсказано для всего 108 олигонуклеотидов, которые имели длину от 17 до 30 нуклеотидов и содержание GC в диапазоне от 8 до 80.

    Статистический анализ

    Все олигонуклеотиды были сгруппированы в три категории — богатые АТ (GC <45%), AT≈GC (содержание GC в диапазоне от 45 до 55%) и богатые GC (GC> 55%).Для каждого олигонуклеотида была рассчитана разница между экспериментально определенным T m и предсказанным T m . {\ hbox {opt}} \ right) \)

    для ПЦР.{+} \ right] \)

    и соответствующие концентрации шаблона. Применение термодинамической модели NN для предсказания T m полимеров было хорошо установлено (Santa Lucia, 1998). Параметры m и n в уравнении (1) были оптимизированы для минимизации ошибки прогнозирования путем пошаговых инкрементных итераций с использованием суммы квадратов. Была предпринята попытка оптимизации без параметров в уравнении (2), поскольку их точность подробно обсуждалась ранее (von Ahsen et al ., 2001).

    Исследования вторичной структуры

    Электрофорез 18 (9 смысловых и 9 антисмысловых, комплементарных) 5′-меченых олигонуклеотидов (20 пмоль) проводили, как описано в Yoshizawa et al . (1997) на 20% полиакриламидном геле, содержащем 7 M мочевины в TBE (pH 8,3) при 4 ° C. Затем это было проанализировано на авторадиограмме. Исследования плавления однонитевых нитей в зависимости от концентрации проводили, чтобы определить, были ли наблюдаемые вторичные структуры самодимерами или шпильками.Количество вторичных структур, которые может образовывать каждый олигонуклеотид, было предсказано с использованием шести различных калькуляторов.

    Исследования по проектированию праймеров

    Девять областей (по 1 т.п.н. каждая) были выбраны из генома человека. Из этих матриц три были AT-богатыми (из генов AMPK, NKX6.1, F3), три имели равные пропорции AT и GC (из генов PKLR, NKX6.1, ISL1), и три были GC-богатыми (из VEGF , IPF1, INS). Анализ Repeat Masker подтвердил, что в этих областях не было повторов.Праймеры были разработаны для амплификации этих областей с использованием 10 бесплатных инструментов для создания праймеров и модуля «Выбор праймеров» DNASTAR. Была синтезирована лучшая пара праймеров, назначенная для каждого инструмента, и была предпринята попытка оптимизации ПЦР. Первоначально праймеры были разработаны, синтезированы и оптимизированы только для одной матрицы каждой категории. После первоначального анализа были проанализированы праймеры еще для двух матриц каждого типа.

    РЕЗУЛЬТАТЫ

    T м прогнозов

    Температура плавления для всех 108 олигонуклеотидов (дополнительная таблица 1), рассмотренных для исследования, была спрогнозирована с использованием 25 калькуляторов свойств олигонуклеотидов.Как упоминалось ранее, в некоторых калькуляторах было более одного модуля, например, Basic, SA и NN. Каждый модуль использует различную методологию для расчета T m . Модули, в которых отсутствовали спецификации принятой методологии, были отнесены к группе «разные». Модули, которые вычисляли Basic T m , не учитывали концентрации солей и олигонуклеотидов. В модулях, которые вычисляют SA T m , значение по умолчанию [Na + ] составляет 50 мМ, а для расчета NN T m значения по умолчанию [Na + ] и [oligo ] составляют 50 мМ и 250 пМ соответственно.В модулях, имевших окно для изменения параметров, были указаны значения [Na + ] и [oligo], при которых экспериментально определялся T m .

    На первом этапе анализа было предсказано T m для всех олигонуклеотидов с использованием всех 56 модулей (дополнительная таблица 2), обеспечивая применимые параметры. Для 60 олигонуклеотидов, для которых T m было определено в пяти различных [Na + ] (Owczarzy et al ., 2004), на этом этапе использовался T m , определенный только при 69 мМ. Для каждого прогноза вычислялись оценки наименьших квадратов и среднеквадратичные значения. Уравнения, которые вычисляют T m с использованием% содержания G + C, плохо работают для олигонуклеотидных дуплексов; в частности, поскольку эти уравнения не учитывают бимолекулярное инициирование и влияние концентрации цепей, что приводит к высоким среднеквадратичным значениям. В результате этого анализа было отобрано 25 модулей, которые имели прогнозы со среднеквадратичными значениями ≤5.GC-содержание олигонуклеотидов не влияло на точность прогнозов.

    T m — это не просто свойство состава олигонуклеотида, но свойство олигонуклеотида в определенных условиях и в данной концентрации. Следовательно, на втором этапе анализа было рассчитано T m для 60 олигонуклеотидов при различных концентрациях [Na + ] (Owczarzy et al. ., 2004) с использованием 17 из 25 модулей (рис.1), в котором было окно для изменения параметров. Выбранные олигонуклеотиды были сгруппированы в AT-богатые (25), AT≈GC (13) и GC-богатые (22) в соответствии с описанным критерием. Для каждого прогноза вычислялись наименьшие квадраты и среднеквадратичные значения. Все модули типа NN принимают дублетный формат предсказания термодинамической стабильности, зависящей от последовательности ДНК, в котором они рассматривают все взаимодействия NN (H-связывание и укладку) в одном параметре (Owczarzy, et al. ., 1997).

    Модули SA не могут работать лучше, чем модули NN.Даже в модулях NN те, которые приняли устаревшие термодинамические параметры (Breslauer et al ., 1986), дали огромное среднее отклонение диапазона T m от диапазона 7 ° C, что хорошо в соответствии с более ранними отчетами (SantaLucia и Хикс, 2004). Модуль Allawi калькулятора MELTING (Le Novere, 2001) с использованием поправок на соль по умолчанию (Santa Lucia, 1998) (http://bioweb.pasteur.fr/seqanal/interfaces/melting.html), NN олигокалькулятора (McLab) ( http://tool.mclab.com/toolbox/oligo_calculator.jsp) и NN T m Расчет для Oligos (Biomath Calculator; Promega) (http://www.promega.com/biomath/default.htm) имел очень меньшее среднее отклонение в прогнозе T m по разному [Na + ] и GC-содержанию (рис. 1). Статистический анализ (таблица 1) показывает, что разница между их средними отклонениями при разных [Na + ] не была значимой ( P > 0,05). Это подчеркивает, что эти калькуляторы работают одинаково хорошо.HYTHER (http://ozone2.chem.wayne.edu/) хорошо показал себя при всех применимых [Na + ] выше 69 мМ, а анализатор Oligo 3.0 (IDT Biotools) при 1020 мМ [Na + ]. Средние отклонения в прогнозах T m HYTHER и Oligo Analyzer 3.0 (IDT Biotools) (http://scitools.idtdna.com/scitools/Applications/OligoAnalyzer/Default.aspx), если рассматривать их отдельно (рис. 1) оказываются меньше при других концентрациях [Na + ], но по сравнению с другими калькуляторами (Таблица 1) их прогнозы значительно отличаются ( P <0.05). Однако, учитывая погрешности экспериментальных определений температуры плавления до 2 ° C, статистически значимые отклонения, наблюдаемые в прогнозах HYTHER при низких концентрациях соли ( P = 0,022), могут быть незначительными с экспериментальной точки зрения. Консенсусный калькулятор температуры плавления (теперь называется dnaMATE 1.0) (http://dna.bio.puc.cl/cardex/servers/dnaMATE/index.html) был недавно разработан, но, похоже, работает не лучше, чем существующие.Мы отмечаем, что 50,92% олигонуклеотидов, которые мы использовали для нашего анализа, находятся в Зоне 2, 25,93% в Зоне 1, 23,15% в Зоне 0 и ни одного в Зоне 3 участков Паньковича. Вкратце, Зона 1 соответствует подобию прогнозов T m между Breslauer и др. . (1986) и Сугимото и др. . (1996); Зона 2 — сходство между Santalucia и др. . (1996) и Сугимото и др. . (1996); Зона 3 между всеми тремя, и в Зоне 0 ни один из наборов параметров NN не имел сходных значений T m (Panjkovich and Melo, 2005).Такое расположение олигонуклеотидов на графиках Паньковича может дать представление о наблюдаемых различиях прогнозов.

    Помимо T m , свободная энергия гибридизации и фракция гибридизованных олигомеров также имеют высокую прогностическую ценность при конструировании олигомеров. {\ hbox {opt}} \)

    Оптимальная температура отжига была предсказана эмпирически для набора из 41 ампликона.{+} \ right] +0,41 (\% \ hbox {GC}) — 528 / n \]

    (4)

    Фактором, ограничивающим широкую применимость этого уравнения, является сдвиг T м , который был эмпирически получено. Наша попытка преодолевает это ограничение и позволяет предсказывать T m наименее стабильного праймера в зависимости от последовательности и состава основания и предсказывать T m продукта на основе термодинамики NN с учетом поправок NN для Mg 2 + и dNTP.Обоснование использования наименее стабильного праймера T m уже было объяснено (von Ahsen et al ., 2001).

    Исследования вторичной структуры

    Мы выбрали комплементарные смысловые и антисмысловые цепи для наших исследований, потому что точно установлено, что предсказанные вторичные структуры дополнительных одиночных цепей не являются зеркальными отображениями и их сворачивание не приводит к такому же уменьшению свободной энергии (Nielsen et al ., 1995). Для выбранных нами последовательностей большое количество вторичных структур было предсказано с помощью различных калькуляторов свойств олигонуклеотидов, включая наиболее широко используемый алгоритм предсказания вторичной структуры, MFOLD (Zuker, 2003) (Таблица 2). Предусмотрены разные прогнозы для смысловой и антисмысловой цепей. Но из рисунка 2 видно, что только олигонуклеотиды 7, 10, 11, 12 и 14 образуют вторичную структуру. Исследования плавления однонитевых цепей в зависимости от концентрации показали, что эти структуры не являются результатом межмолекулярных взаимодействий.Следовательно, эти структуры считаются шпильками. Присутствие незначительных вторичных структур в этих олигонуклеотидах при 4 ° C вызывает сомнения относительно простого существования стабильных структур при температурах, используемых во время экспериментов в области молекулярной биологии, ставя под сомнение достоверность таких прогнозов. Однако все программы, кроме калькулятора свойств олигонуклеотидов, предоставляют свободную энергию предсказанных структур. Отметим, что это может дать информацию об устойчивости прогнозируемых структур.

    Исследования по проектированию праймеров

    Подробная информация о производительности каждого рассматриваемого инструмента для разработки праймеров сведена в таблицу (Таблица 3). Хотя биологи могут изменять последовательность праймера, целевая ДНК не может быть изменена. Обычно мало внимания уделяется анализу матрицы ПЦР перед экспериментальной процедурой. Пытаясь решить эту проблему, мы выбрали шаблоны AT-rich, GC-rich и AT = GC для проверки производительности различных инструментов. В первоначальном анализе праймеры, полученные с помощью Primer Selection, работали хорошо.Web Primer, Primer 3 и Primer Design Assistant приводили к амплификации только в шаблонах, богатых AT и GC, а те, которые были созданы с помощью Do Primer, Exon Primer и Pride 1.2 (Haas et al ., 1998), хорошо работали для AT- rich и AT = GC шаблоны. Для второй фазы анализа праймер Do и выбор праймеров не были доступны во всемирной паутине. Второй этап был проведен только по оставшимся девяти инструментам. В категории Primer 3 и Web Primer, богатой AT, в праймере AT = GC Exon и в категории Primer Design Assistant, в категории Primer Design Assistant, Primer 3 и Primer Quest показали лучшие результаты.Только одна из трех последовательностей в классе AT = GC могла быть амплифицирована с использованием праймеров, полученных с помощью Primer 3. Primer 3 удобен для пользователя, поскольку он учитывает широкий диапазон параметров и предоставляет их полное описание, но использование устаревших параметров Breslauer (Breslauer et al ., 1986) является его основным недостатком. Сложности разработки праймеров в сети (Binas, 2000) и детали инструментов разработки праймеров уже были рассмотрены ранее (Abd-Elsalam, 2003). Мы подчеркиваем, что никакая причина не приписывается ни неудачам одних инструментов, ни успехам других.

    ОБСУЖДЕНИЕ

    В этой работе мы сравнили различные калькуляторы свойств олигонуклеотидов для оценки T m олигонуклеотидов и выполнили тест точности с использованием всех соответствующих последовательностей, для которых доступны экспериментальные данные о плавлении. Цель этого исследования — не дисквалифицировать какой-либо из существующих методов, а продемонстрировать, что между ними наблюдаются значительные различия в предсказаниях коротких последовательностей ДНК T m , когда тестируется большое количество последовательностей, имеющих практическое значение. .Такая оценка до некоторой степени предвзята, поскольку большинство доступных экспериментальных данных соответствуют очень коротким последовательностям ДНК, а также использовались для оптимизации и параметризации существующих методов, а имеющиеся в настоящее время данные также не являются репрезентативными для пространства олигонуклеотидных последовательностей. Этот анализ охватывает все известные параметры, необходимые для оценки точности прогнозов, такие как GC-содержание олигонуклеотида, концентрация соли, при которой он плавится, концентрация цепи и длина последовательности.{\ hbox {opt}} \)

    , объединяющий составы, разработанные несколькими группами, можно применять в разных лабораториях, просто найдя наилучшее соответствие для m и n в уравнении (1) из уже существующего набора данных ампликона. Точность этой модели зависит от точности значений, полученных для m и n . Здесь мы демонстрируем использование термодинамики NN для прогнозирования T m продукта.

    Такие соображения, как предотвращение комплементарности на 3′-концах праймеров, которая способствует образованию артефактов праймер-димер, и предотвращение стабильных самокомплементарных шпилечных петель, которые повышают стабильность праймера, необходимы для повышения специфичности олигонуклеотидов.Хотя для определенных наборов праймеров было предсказано большое количество вторичных структур, в этих случаях наблюдались успешная амплификация и хороший выход продукта. Хотя аппроксимации на основе длины дали важные предсказания, необходимы правила и параметры, зависящие от последовательности, для шпилек, выпуклостей, внутренних и многоразветвленных петель. Уточнение термодинамических параметров, характеризующих различные структурные мотивы, и включение поправок на концентрации двухвалентных катионов (необходимых для ферментативной активности) необходимы для дальнейшего улучшения качества этих прогнозов (SantaLucia and Hicks, 2004).Мы подчеркиваем, что предсказание правильной вторичной структуры — не единственная цель, но также важно точное предсказание энергии, необходимой для разворачивания части длинной ДНК, чтобы олигонуклеотид мог связываться (Dong et al ., 2001), и упоминание об этом в программе будет большим подспорьем для наивных пользователей. Когда зонд или праймер имеет некоторые вторичные структуры, возникает конкуренция между образованием вторичной структуры и связыванием мишени. Соответствующие склонности к образованию вторичной структуры и образованию дуплекса в конечном итоге определяют актуальность данной вторичной структуры.Чтобы оценить результат этого соревнования, требуется предсказание свободных энергий. Таким образом, мы предупреждаем конечных пользователей об исключении в остальном хороших праймеров во время разработки праймеров для различных приложений только на основе количества вторичных структур, предсказанных программным обеспечением, которое они используют.

    Хотя есть роскошь экспериментальной оптимизации различных параметров, плохие прогнозы в дизайне праймеров могут быть недопустимыми. Затраты и время на эксперименты огромны, поэтому минимизация сбоев крайне важна.Общие показатели успеха ПЦР обычно скомпрометированы из-за различий в последовательности и длине матрицы. Также сообщалось, что регионализированное GC-содержание матричной ДНК является сильным предиктором успеха ПЦР (Benita et al ., 2003). Используя три разные категории шаблонов для анализа, мы даем представление о том, какой инструмент обеспечивает лучший дизайн в зависимости от содержимого GC шаблона. Различные инструменты идут на компромисс по разным соображениям и, следовательно, страдают множеством ограничений.Хотя это не исчерпывающее упражнение для определения эффективности каждого инструмента, наше исследование действительно дает представление об этом аспекте. Мы полагаем, что этот сравнительный анализ предоставит некоторые руководящие принципы, которым необходимо следовать, чтобы избежать или свести к минимуму крупные и частые ошибки при разработке праймеров.

    Мы с готовностью признаем, что это исследование направлено на обеспечение безопасного применения текущих методов, доступных бесплатно для всех, с учетом их ограничений и ограничений, а не на разработку новых методов или добавление еще одного программного обеспечения или сервера к существующим.Мы считаем, что наше исследование поможет в увеличении успеха различных практических приложений, связанных с олигонуклеотидами.

    Рис. 1

    Сравнение различных калькуляторов свойств олигонуклеотидов с окном для изменения концентраций соли и олигонуклеотидов. Сравниваются прогнозы для пяти различных концентраций [Na + ]. Значение, указанное для каждого столбца, обеспечивает среднее отклонение T м (° C) в прогнозах каждого калькулятора при указанной концентрации [Na + ].Номер, указанный в квадратных скобках, соответствует серийному номеру. модуля в дополнительной таблице 2.

    Рис. 1

    Сравнение различных калькуляторов свойств олигонуклеотидов с окном для изменения концентраций соли и олигонуклеотидов. Сравниваются прогнозы для пяти различных концентраций [Na + ]. Значение, указанное для каждого столбца, обеспечивает среднее отклонение T м (° C) в прогнозах каждого калькулятора при указанной концентрации [Na + ].Номер, указанный в квадратных скобках, соответствует серийному номеру. модуля в дополнительной таблице 2.

    Таблица 1

    Статистический анализ средних отклонений в T м прогнозов

    0,475

    75675955 NN55472

    Модули
    .
    Тип
    .
    P -значения для среднего T m прогноз при разных [Na + ]
    .
    . . 69 мМ
    .
    119 мМ
    .
    220 мМ
    .
    621 мМ
    .
    1020 мМ
    .
    Анализатор олиго 3.0 (IDT Biotools) NN <0,0001 <0,0001 <0,0001 <0,0001 0,0001 <0,0001 0 ti

    Свойства Oligonu550001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор свойств олигонуклеотидов NN <0,0001

    0,0001

    Анализатор олигонуклеотидов (РНК-структура) NN <0,0001 <0,0001 <0,0001 <0,0001 <0.0001
    Калькулятор Oligo (McLab) SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    N 0,055 0,241 0,667
    T m расчет для олигонуклеотидов (калькулятор Biomath; Promega) NN 0.073 LD LD LD 0,295
    Биополимерный калькулятор (лаборатория Schepartz) SA 0,011 0,0054 0.102 6

    1

    1

    m calc (Roche) Разное <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    MELTING-Allawi 0,0524 0,405 0,661
    ПЛАВЛЕНИЕ-Сугимото 95 NN <0,0001 <0,0001 <0,0001 93.0006 0,0001 <0,0001 93.0006 5

    0,0001 93.0006

    5

    NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Анализатор последовательности (Synthegen) NN <0.0001 <0,0001 <0,0001 <0,0001 0,0004
    Калькулятор температуры плавления SA <0,0001 <0,0001 6

    1

    1

    Калькулятор температуры плавления; Сугимото NN <0,0001 <0,0001 0,0065 <0,0001 <0.0001
    Калькулятор температуры плавления; Консенсус NN <0,0001 <0,0001 0,007 <0,0001 <0,0001
    Термодинамика гибридизации (HYTHER) 0,125

    9376

    9376

    9376

    NN6 нет в наличии
    55 Калькулятор свойств олигонуклеотидов

    75 937 937 937 937 937

    01

    Модули
    .
    Тип
    .
    P -значения для среднего T m прогноз при разных [Na + ]
    .
    . . 69 мМ
    .
    119 мМ
    .
    220 мМ
    .
    621 мМ
    .
    1020 мМ
    .
    Oligo analyzer 3.0 (IDT Biotools) NN <0.0001 <0,0001 <0,0001 <0,0001 LD
    Калькулятор свойств олигонуклеотидов SA <0,0001 9376 9375 0,0001 93.0006

    NN <0,0001 <0,0001 <0,0001 <0,0001 <0.0001
    Анализатор олигонуклеотидов (РНК-структура) NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001 5

    (калькулятор)

    <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор Oligo (McLab) NN 0,795 0.475 0,055 0,241 0,667
    T m расчет для олигонуклеотидов (калькулятор Biomath; Promega) NN 0,073 LD Биополимерный калькулятор (лаборатория Schepartz) SA 0,011 0,0054 0,102 <0,0001 <0,0001
    T m calc6 955 937 937 955 937 937 937 9379 <0,0001 <0,0001 <0,0001 <0,0001
    ПЛАВЛЕНИЕ-Allawi NN LD 0,472 9375 9375 9375 9376 NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    MELTING-Sugimoto 96 NN <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
    Анализатор последовательности (Synthegen) NN <0,0001 <0,0006. 1 <0,0006 6

    Калькулятор температуры плавления SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
    Калькулятор температуры плавления; Консенсус NN <0,0001 <0,0001 0,007 <0,0001 <0,0001
    Термодинамика гибридизации (HYTHER) 0,125

    9376

    9376

    9376

    NN6 нет данных

    Таблица 1

    Статистический анализ средних отклонений в T м прогнозов

    975

    937

    Модули
    .
    Тип
    .
    P -значения для среднего T m прогноз при разных [Na + ]
    .
    . . 69 мМ
    .
    119 мМ
    .
    220 мМ
    .
    621 мМ
    .
    1020 мМ
    .
    Анализатор олиго 3.0 (IDT Biotools) NN <0,0001 <0,0001 <0,0001 <0,0001 LD
    Калькулятор свойств олигонуклеотидов1376

    6

    6

    6 93.000

    <0,0001 <0,0001
    Калькулятор свойств олигонуклеотидов NN <0,0001 <0,0001 <0.0001 <0,0001 <0,0001
    Анализатор олигонуклеотидов (РНК-структура) NN <0,0001 <0,0001 <037551 1

    1 1

    9 SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор Oligo (McLab) NN 0.795 0,475 0,055 0,241 0,667
    T m расчет для олигонуклеотидов (калькулятор Biomath; Promega) NN 0,073 NN 0,073
    Биополимерный калькулятор (лаборатория Schepartz) SA 0,011 0,0054 0,102 <0,0001 <0,0001
    M 0
    Разное 0 0.0001 <0,0001 <0,0001 <0,0001 <0,0001
    ПЛАВЛЕНИЕ-Allawi NN LD 0,472 9375 9375 9375 9376 NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    MELTING-Sugimoto 96 NN <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
    Анализатор последовательности (Synthegen) NN <0,0001 <0,0006. 1 <0,0006 6

    Калькулятор температуры плавления SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
    Калькулятор температуры плавления; Консенсус NN <0,0001 <0,0001 0,007 <0,0001 <0,0001
    Термодинамика гибридизации (HYTHER) 0,125

    9376

    9376

    9376

    NN6 нет в наличии

    975

    937

    Модули
    .
    Тип
    .
    P -значения для среднего T m прогноз при разных [Na + ]
    .
    . . 69 мМ
    .
    119 мМ
    .
    220 мМ
    .
    621 мМ
    .
    1020 мМ
    .
    Анализатор олиго 3.0 (IDT Biotools) NN <0,0001 <0,0001 <0,0001 <0,0001 LD
    Калькулятор свойств олигонуклеотидов1376

    6

    6

    6 93.000

    <0,0001 <0,0001
    Калькулятор свойств олигонуклеотидов NN <0,0001 <0,0001 <0.0001 <0,0001 <0,0001
    Анализатор олигонуклеотидов (РНК-структура) NN <0,0001 <0,0001 <037551 1

    1 1

    9 SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор Oligo (McLab) NN 0.795 0,475 0,055 0,241 0,667
    T m расчет для олигонуклеотидов (калькулятор Biomath; Promega) NN 0,073 NN 0,073
    Биополимерный калькулятор (лаборатория Schepartz) SA 0,011 0,0054 0,102 <0,0001 <0,0001
    M 0
    Разное 0 0.0001 <0,0001 <0,0001 <0,0001 <0,0001
    ПЛАВЛЕНИЕ-Allawi NN LD 0,472 9375 9375 9375 9376 NN <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    MELTING-Sugimoto 96 NN <0.0001 <0,0001 <0,0001 <0,0001 <0,0001
    Анализатор последовательности (Synthegen) NN <0,0001 <0,0006. 1 <0,0006 6

    Калькулятор температуры плавления SA <0,0001 <0,0001 <0,0001 <0,0001 <0,0001
    Калькулятор температуры плавления; Сугимото NN <0.0001 <0,0001 0,0065 <0,0001 <0,0001
    Калькулятор температуры плавления; Консенсус NN <0,0001 <0,0001 0,007 <0,0001 <0,0001
    Термодинамика гибридизации (HYTHER) 0,125

    9376

    9376

    9376

    9376

    NN6 нет в наличии

    Фиг.2

    Анализ вторичных структур олигонуклеотидов. C1: Т-21; C2: Т-24; С3: Т-18. Номера олигонуклеотидов соответствуют последовательностям в таблице 3.

    Рис. 2

    Анализ вторичных структур в олигонуклеотидах. C1: Т-21; C2: Т-24; С3: Т-18. Номера олигонуклеотидов соответствуют последовательностям в таблице 3.

    Таблица 2

    Прогнозы вторичной структуры различными инструментами

    37

    37

    37

    75 9376 955 955 2 9337

    75 9376 955 2 9337

    75 9376 955 2

    75 9376 955 2

    955 937 9355 937

    955 937 9355 937 9355 9376 955 937 9355

    9376 8

    1

    TT20

    937GAT55 937GATTC

    956

    S.нет.
    .
    Олигонуклеотидная последовательность
    .
    MFOLD
    .
    Oligo Analyzer 3.0 (IDT Biotools)
    .
    Калькулятор свойств олигонуклеотидов
    .
    Net Primer (Premier Biosoft)
    .
    Анализатор олигонуклеотидов (РНК-структура)
    .
    Выбор праймера (DNA STAR)
    .
    л.

    2 8 2 0 0 1 1 1 1 6 3
    2 5

    5

    5 9376AATCATC

    5 9376AATC

    5 9376

    5 GGACCC

    0 1 1 1 1 1 5 3
    3 CTCCGGGGGCCACACTCACTCACGC 7 1 7 1 7

    7 1 0 1 1 4 4
    4 9 3756

    GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8

    06

    937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 8 2 0 0 1 1 1 1 4 7
    6 5 5 5

    5 5

    4 2 1 1 7 7
    7 AAAACAAAGACTTTCTTAAGAGAT 2 8 8 8 8 1 6 15
    8 ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
    6 937CTATTTC

    937CTATTC

    937CTATTTC

    937CTATTTTC

    937AG6 1 2 2 8 1 1 1 10 10
    10 TCTAGCTAATATATGAAACATATG 2 1 1 9 10
    11 AAGTGACAAGGATGGGCCTCAATC 1 1 7

    1 9375 9355 9375 9375

    7

    7 1 9375 9355 9375 9375 9375

    7

    7 1 0 7 1 10 7
    12 GATTGAGGCCCATCCTTGTCACTT 9 3756

    2 8 1 0 0 2 1 1 1 5 7
    13 937GAT55 937GAT55 937GAT55 937GAT55

    937GAT55 937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55 937GAT55

    937A55 4 0 3 0 1 1 9 12
    14 AACATCATGAAAATTTTACATCTC55 6756 9376 9376 9376 9376 9376

    9375 9355 9375 9355 9376 955 9376 955 9376 0 1 1 7 12
    15 TTAGGTCAGTGGTCCCAAGTAG 3 8 037 9355

    1 037 937 1 5 4
    16 CTACTTGGGACCACTGACCTAA 5 9 3756

    8 2 0 0 0 0 1 1 5 4
    TGAG675CAGCC 5 0 0 0 1 1 3 5
    18 CTCAACGGGGCTGCCTCA 4 5

    5

    5

    5 955

    5 955

    5

    5 955

    5

    5

    5 1 1 7 5

    37

    37

    37

    75 9376 955 955 2 9337

    75 9376 955 2 9337

    75 9376 955 2

    75 9376 955 2

    955 937 9355 937

    955 937 9355 937 9355 9376 955 937 9355

    9376 8

    1

    TT20

    937GAT55 937GATTC

    956

    S.нет.
    .
    Олигонуклеотидная последовательность
    .
    MFOLD
    .
    Oligo Analyzer 3.0 (IDT Biotools)
    .
    Калькулятор свойств олигонуклеотидов
    .
    Net Primer (Premier Biosoft)
    .
    Анализатор олигонуклеотидов (РНК-структура)
    .
    Выбор праймера (DNA STAR)
    .
    л.

    2 8 2 0 0 1 1 1 1 6 3
    2 5

    5

    5 9376AATCATC

    5 9376AATC

    5 9376

    5 GGACCC

    0 1 1 1 1 1 5 3
    3 CTCCGGGGGCCACACTCACTCACGC 7 1 7 1 7

    7 1 0 1 1 4 4
    4 9 3756

    GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8

    06

    937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 8 2 0 0 1 1 1 1 4 7
    6 5 5 5

    5 5

    4 2 1 1 7 7
    7 AAAACAAAGACTTTCTTAAGAGAT 2 8 8 8 8 1 6 15
    8 ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
    6 937CTATTTC

    937CTATTC

    937CTATTTC

    937CTATTTTC

    937AG6 1 2 2 8 1 1 1 10 10
    10 TCTAGCTAATATATGAAACATATG 2 1 1 9 10
    11 AAGTGACAAGGATGGGCCTCAATC 1 1 7

    1 9375 9355 9375 9375

    7

    7 1 9375 9355 9375 9375 9375

    7

    7 1 0 7 1 10 7
    12 GATTGAGGCCCATCCTTGTCACTT 9 3756

    2 8 1 0 0 2 1 1 1 5 7
    13 937GAT55 937GAT55 937GAT55 937GAT55

    937GAT55 937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55 937GAT55

    937A55 4 0 3 0 1 1 9 12
    14 AACATCATGAAAATTTTACATCTC55 6756 9376 9376 9376 9376 9376

    9375 9355 9375 9355 9376 955 9376 955 9376 0 1 1 7 12
    15 TTAGGTCAGTGGTCCCAAGTAG 3 8 037 9355

    1 037 937 1 5 4
    16 CTACTTGGGACCACTGACCTAA 5 9 3756

    8 2 0 0 0 0 1 1 5 4
    TGAG675CAGCC 5 0 0 0 1 1 3 5
    18 CTCAACGGGGCTGCCTCA 4 5

    5 955

    5

    5 955

    5

    5

    5

    5

    5

    5 1 1 7 5

    Таблица 2

    Прогнозы вторичной структуры различных инструментов

    37

    37

    37

    75 9376 955 955 2 9337

    75 9376 955 2 9337

    75 9376 955 2

    75 9376 955 2

    955 937 9355 937

    955 937 9355 937 9355 9376 955 937 9355

    9376 8

    1

    TT20

    937GAT55 937GATTC

    956

    S.нет.
    .
    Олигонуклеотидная последовательность
    .
    MFOLD
    .
    Oligo Analyzer 3.0 (IDT Biotools)
    .
    Калькулятор свойств олигонуклеотидов
    .
    Net Primer (Premier Biosoft)
    .
    Анализатор олигонуклеотидов (РНК-структура)
    .
    Выбор праймера (DNA STAR)
    .
    л.

    2 8 2 0 0 1 1 1 1 6 3
    2 5

    5

    5 9376AATCATC

    5 9376AATC

    5 9376

    5 GGACCC

    0 1 1 1 1 1 5 3
    3 CTCCGGGGGCCACACTCACTCACGC 7 1 7 1 7

    7 1 0 1 1 4 4
    4 9 3756

    GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8

    06

    937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 8 2 0 0 1 1 1 1 4 7
    6 5 5 5

    5 5

    4 2 1 1 7 7
    7 AAAACAAAGACTTTCTTAAGAGAT 2 8 8 8 8 1 6 15
    8 ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
    6 937CTATTTC

    937CTATTC

    937CTATTTC

    937CTATTTTC

    937AG6 1 2 2 8 1 1 1 10 10
    10 TCTAGCTAATATATGAAACATATG 2 1 1 9 10
    11 AAGTGACAAGGATGGGCCTCAATC 1 1 7

    1 9375 9355 9375 9375

    7

    7 1 9375 9355 9375 9375 9375

    7

    7 1 0 7 1 10 7
    12 GATTGAGGCCCATCCTTGTCACTT 9 3756

    2 8 1 0 0 2 1 1 1 5 7
    13 937GAT55 937GAT55 937GAT55 937GAT55

    937GAT55 937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55 937GAT55

    937A55 4 0 3 0 1 1 9 12
    14 AACATCATGAAAATTTTACATCTC55 6756 9376 9376 9376 9376 9376

    9375 9355 9375 9355 9376 955 9376 955 9376 0 1 1 7 12
    15 TTAGGTCAGTGGTCCCAAGTAG 3 8 037 9355

    1 037 937 1 5 4
    16 CTACTTGGGACCACTGACCTAA 5 9 3756

    8 2 0 0 0 0 1 1 5 4
    TGAG675CAGCC 5 0 0 0 1 1 3 5
    18 CTCAACGGGGCTGCCTCA 4 5

    5

    5

    5 955

    5 955

    5

    5 955

    5

    5

    5 1 1 7 5

    37

    37

    37

    75 9376 955 955 2 9337

    75 9376 955 2 9337

    75 9376 955 2

    75 9376 955 2

    955 937 9355 937

    955 937 9355 937 9355 9376 955 937 9355

    9376 8

    1

    TT20

    937GAT55 937GATTC

    956

    S.нет.
    .
    Олигонуклеотидная последовательность
    .
    MFOLD
    .
    Oligo Analyzer 3.0 (IDT Biotools)
    .
    Калькулятор свойств олигонуклеотидов
    .
    Net Primer (Premier Biosoft)
    .
    Анализатор олигонуклеотидов (РНК-структура)
    .
    Выбор праймера (DNA STAR)
    .
    л.

    2 8 2 0 0 1 1 1 1 6 3
    2 5

    5

    5 9376AATCATC

    5 9376AATC

    5 9376

    5 GGACCC

    0 1 1 1 1 1 5 3
    3 CTCCGGGGGCCACACTCACTCACGC 7 1 7 1 7

    7 1 0 1 1 4 4
    4 9 3756

    GCGTGAGTGTGGCCCCCGGAG 6 8 1 0 0 2 0 1 1 8

    06

    937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 937G6 935 8 2 0 0 1 1 1 1 4 7
    6 5 5 5

    5 5

    4 2 1 1 7 7
    7 AAAACAAAGACTTTCTTAAGAGAT 2 8 8 8 8 1 6 15
    8 ATCTCTTAAGAAAGTC TTTGTTTT 5 8 2 2 0 5 2 1 1 10 15
    6 937CTATTTC

    937CTATTC

    937CTATTTC

    937CTATTTTC

    937AG6 1 2 2 8 1 1 1 10 10
    10 TCTAGCTAATATATGAAACATATG 2 1 1 9 10
    11 AAGTGACAAGGATGGGCCTCAATC 1 1 7

    1 9375 9355 9375 9375

    7

    7 1 9375 9355 9375 9375 9375

    7

    7 1 0 7 1 10 7
    12 GATTGAGGCCCATCCTTGTCACTT 9 3756

    2 8 1 0 0 2 1 1 1 5 7
    13 937GAT55 937GAT55 937GAT55 937GAT55

    937GAT55 937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55

    937GAT55 937GAT55

    937A55 4 0 3 0 1 1 9 12
    14 AACATCATGAAAATTTTACATCTC55 6756 9376 9376 9376 9376 9376

    9375 9355 9375 9355 9376 955 9376 955 9376 0 1 1 7 12
    15 TTAGGTCAGTGGTCCCAAGTAG 3 8 037 9355

    1 037 937 1 5 4
    16 CTACTTGGGACCACTGACCTAA 5 9 3756

    8 2 0 0 0 0 1 1 5 4
    TGAG675CAGCC 5 0 0 0 1 1 3 5
    18 CTCAACGGGGCTGCCTCA 4 5

    5

    5

    5 955

    5 955

    5

    5

    5

    5

    5 1 1 7 5

    Таблица 3

    Подробная информация об инструментах для создания праймеров и их характеристиках

    Таблица 3

    Подробная информация об инструментах для создания праймеров и их характеристиках

    Авторы благодарны проф.С.К. Брахмачари, директору IGIB за его поддержку. Авторы благодарят г-жу Виджайю Банерджи и г-на Амитабха Шарму (Институт геномики и интегративной биологии) за их критический вклад. Авторы выражают признательность доктору К. Нараянасами и господину Мохду Надиму Хану (Центр геномных приложений) за их помощь в синтезе олигонуклеотидов. SC, AM и RT выражают признательность CSIR, правительству Индии, за предоставление стипендий для докторантуры. Это исследование было поддержано проектом целевой группы CSIR «Прогнозирующая медицина с использованием повторяющихся и однонуклеотидных полиморфизмов» (CMM0016) и проектом «Генетические и протеомные исследования при сахарном диабете» (OLP 0030), финансируемым CSIR.Авторы также благодарят д-ра Алекса Бейтмана, исполнительного редактора Bioinformatics, за предоставленную им возможность опубликовать свою работу.

    Конфликт интересов : не объявлен.

    ССЫЛКИ

    Абд-Эльсалам, К.А.

    2003

    Биоинформатические инструменты и руководство по разработке праймеров для ПЦР.

    Afr. J. Biotechnol.

    2

    91

    –95

    Allawi, H.T. и Santa Lucia, J., Jr.

    1997

    Термодинамика и ЯМР внутренних несоответствий G – T в ДНК.

    Биохимия

    36

    10581

    –10594

    Benita, Y., et al.

    2003

    Региональное GC-содержание матричной ДНК как предиктор успеха ПЦР.

    Nucleic Acids Res.

    31

    e99

    Binas, M.

    2000

    Разработка праймеров для ПЦР в Интернете.

    Biotechniques

    29

    988

    –990

    Breslauer, K.J., et al.

    1986

    Прогнозирование стабильности дуплекса ДНК на основе последовательности оснований.

    Proc. Natl Acad. Sci. США

    83

    3746

    –3750

    Cantor, R.C., et al.

    1970

    Олигонуклеотидные взаимодействия. III. Изучение кругового дихроизма конформации дезоксиолигонуклеотидов и аналогов дезоксиолигонуклеотидов.

    Биополимеры

    9

    1059

    –1077

    Caruthers, M.H. В Гассене, Х.Г. и Ланг, А. (ред.).

    Химический и ферментативный синтез фрагментов генов. Лабораторное руководство

    1982

    , Вайнхайм, Германия Verag-Chemie, стр.

    71

    –79

    Dong, F., et al.

    2001

    Предсказание вторичной структуры и структурно-специфический анализ последовательности одноцепочечной ДНК.

    Nucleic Acids Res.

    29

    3248

    –3257

    Федорова О.С. и др.

    1992

    Влияние целевой структуры на эффективность алкилирования одноцепочечной ДНК реактивными производными антисмысловых олигонуклеотидов.

    FEBS Lett.

    302

    47

    –50

    Freier, S.М., et al.

    1986

    Улучшенные параметры свободной энергии для предсказания стабильности дуплекса РНК.

    Proc. Natl Acad. Sci. США

    83

    9373

    –9377

    Gamper, H.B., et al.

    1987

    Гибридизация в растворе сшиваемых ДНК-олигонуклеотидов с ДНК бактериофага M13. Влияние вторичной структуры на кинетику и равновесие гибридизации.

    J. Mol. Биол.

    197

    349

    –362

    Haas, S., et al.

    1998

    Дизайн праймера для крупномасштабного секвенирования.

    Nucleic Acids Res.

    26

    3006

    –3012

    Howley, P.M., et al.

    1979

    Быстрый метод обнаружения и картирования гомологии между гетерологичными ДНК. Оценка геномов полиомавирусов.

    J. Biol. Chem.

    254

    4876

    –4883

    Le Novere, N.

    2001

    MELTING, вычисление температуры плавления дуплекса нуклеиновой кислоты.

    Биоинформатика

    17

    1226

    –1227

    Мармур, Дж.and Dotty, P.

    1962

    Определение основного состава дезоксирибонуклеиновой кислоты по температуре ее термической денатурации.

    J. Mol. Биол.

    5

    109

    –118

    Nakano, S., et al.

    1999

    Стабильность дуплекса нуклеиновой кислоты: влияние состава основания на катионные эффекты.

    Nucleic Acids Res.

    27

    2957

    –2965

    Nielsen, D.A., et al.

    1995

    Дизайн праймера SSCP на основе однонитевой структуры ДНК, предсказанной программой фолдинга ДНК.

    Nucleic Acids Res.

    23

    2287

    –2291

    Owczarzy, R., et al.

    1997

    Прогнозирование зависящей от последовательности стабильности плавления коротких дуплексных олигомеров ДНК.

    Биополимеры

    44

    217

    –239

    Owczarzy, R., et al.

    2004

    Влияние ионов натрия на дуплексные олигомеры ДНК: улучшенные предсказания температур плавления.

    Биохимия

    43

    3537

    –3554

    Панькович А. и Мело Ф.

    2005

    Сравнение различных методов расчета температуры плавления для коротких последовательностей ДНК.

    Bioinformatics

    21

    711

    –722

    Робертсон, Дж. М. и Уолш-Веллер, Дж.

    1998

    Введение в дизайн праймеров для ПЦР и оптимизацию реакций амплификации.

    Methods Mol. Биол.

    98

    121

    –154

    Rychlik, W., et al.

    1990

    Оптимизация температуры отжига для амплификации ДНК in vitro .

    Nucleic Acids Res.

    18

    6409

    –6412

    SantaLucia, J., Jr.

    1998

    Единый взгляд на термодинамику ближайшего соседа полимерной, гантельной и олигонуклеотидной ДНК.

    Proc. Natl Acad. Sci. США

    95

    1460

    –1465

    Санта-Люсия, Дж., Младший и Хикс, Д.

    2004

    Термодинамика структурных мотивов ДНК.

    Annu. Rev. Biophys. Biomol. Struct.

    33

    415

    –440

    SantaLucia, J., Jr, et al.

    1996

    Улучшенные параметры ближайшего соседа для прогнозирования стабильности дуплекса ДНК.

    Биохимия

    35

    3555

    –3562

    Sugimoto, N., et al.

    1995

    Термодинамические параметры для прогнозирования стабильности гибридных дуплексов РНК / ДНК.

    Биохимия

    34

    11211

    –11216

    Sugimoto, N., et al.

    1996

    Улучшенные термодинамические параметры и фактор инициации спирали для прогнозирования стабильности дуплексов ДНК.

    Nucleic Acids Res.

    24

    4501

    –4505

    vonAhsen, N., et al.

    2001

    Температуры плавления олигонуклеотидов в условиях ПЦР: поправки на ближайшего соседа для концентрации Mg 2+ , дезоксинуклеотидтрифосфата и диметилсульфоксида по сравнению с альтернативными эмпирическими формулами.

    Clin. Chem.

    47

    1956

    –1961

    Wallace, R.B., et al.

    1979

    Гибридизация синтетических олигодезоксирибонуклеотидов с ДНК phi chi 174: эффект несоответствия одной пары оснований.

    Nucleic Acids Res.

    6

    3543

    –3557

    Xia, T., et al.

    1998

    Термодинамические параметры для расширенной модели ближайшего соседа для образования дуплексов РНК с парами оснований Уотсона – Крика.

    Биохимия

    37

    14719

    –14735

    Yoshizawa, S., et al.

    1997

    Последовательности тринуклеотидной петли GNA, продуцирующие необычайно стабильные мини-гайрпины ДНК.

    Биохимия

    36

    4761

    –4767

    Цукер, М.

    2003

    Веб-сервер Mfold для предсказания сворачивания нуклеиновых кислот и гибридизации.

    Nucleic Acids Res.

    31

    3406

    –3415

    Разработка прокариотического универсального праймера для одновременного анализа бактерий и архей с использованием секвенирования нового поколения

    Abstract

    Критически важным шагом для анализа структуры микробного сообщества на основе разнообразия последовательностей 16S рДНК является чувствительная и надежная ПЦР-амплификация 16S рДНК.Чтобы получить точные данные о микробном составе, амплификация ПЦР не должна иметь систематической ошибки; однако амплификация всех видов 16S рДНК с одинаковой эффективностью из образца, содержащего большое количество микроорганизмов, остается сложной задачей. Здесь мы разработали универсальный праймер на основе гипервариабельной области V3-V4 прокариотической 16S рДНК для одновременного обнаружения бактерий и Archaea в образцах фекалий гибридных свиней (Landrace × Large white × Duroc) с использованием Illumina MiSeq next -генерационный секвенсор.Анализ In-silico показал, что недавно разработанные универсальные прокариотические праймеры соответствовали приблизительно 98,0% последовательностей бактерий и 94,6% последовательностей гена рРНК архей в базе данных проекта Ribosomal Database Project. Для каждой реакции секвенирования, проведенной с универсальным прокариотическим праймером, было получено в среднем 69 330 (± 20 482) прочтений, из которых гены архейной рРНК составляли приблизительно от 1,2% до 3,2% от всех прокариотических прочтений. Кроме того, частота обнаружения бактерий , принадлежащих к типу Verrucomicrobia , включая представителей классов Verrucomicrobiae и Opitutae , была выше в NGS-анализе с использованием универсального прокариотического праймера, чем с универсальным бактериальным праймером. .Важно отметить, что этот новый набор универсальных праймеров для прокариот имел заметно меньшее смещение, чем у большинства ранее разработанных универсальных праймеров. Наши результаты показывают, что универсальный набор праймеров для прокариот, разработанный в настоящем исследовании, позволит одновременно обнаруживать бактерий и архей и, следовательно, позволит более полно понять структуры микробного сообщества в образцах окружающей среды.

    Образец цитирования: Takahashi S, Tomita J, Nishioka K, Hisada T., Nishijima M (2014) Разработка прокариотического универсального праймера для одновременного анализа бактерий и Archaea с использованием секвенирования следующего поколения.PLoS ONE 9 (8):
    e105592.

    https://doi.org/10.1371/journal.pone.0105592

    Редактор: Костас Бурцис, Международное агентство по атомной энергии, Австрия

    Поступило: 29 апреля 2014 г .; Одобрена: 26 июля 2014 г .; Опубликовано: 21 августа 2014 г.

    Авторские права: © 2014 Takahashi et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Авторы подтверждают, что все данные, лежащие в основе результатов, полностью доступны без ограничений. Все данные, лежащие в основе результатов исследования, доступны либо в рукописи, либо из архива последовательного чтения Японского банка данных (DDBJ) под регистрационным номером DRA002295.

    Финансирование: У авторов нет поддержки или финансирования, чтобы сообщить.

    Конкурирующие интересы: Все авторы являются оплачиваемыми сотрудниками компании TechnoSuruga Laboratory Co., Ltd. (Нагасаки, Япония). Однако такая принадлежность не меняет приверженности авторов политике PLOS ONE в отношении обмена данными и материалами.

    Введение

    Анализ 16S рРНК (16S рДНК) предоставляет ценную филогенетическую информацию для сравнения микробного разнообразия в образцах окружающей среды. Ряд молекулярно-биологических методов, основанных на разнообразии последовательностей гена 16S рДНК, был разработан для исследования структуры микробного сообщества. Среди этих методов часто используются методы снятия отпечатков пальцев, такие как денатурирующий градиентный гель-электрофорез (DGGE) [1] — [3] и полиморфизм длины концевого рестрикционного фрагмента (T-RFLP) [4] — [6], поскольку они просты в использовании. использования и относительно невысокая стоимость [7].Создание библиотек клонов 16S рДНК также широко используется для изучения структуры микробного сообщества [2], [4], [8]. Однако, поскольку эти независимые от культуры подходы, по оценкам, выявляют только 0,1% ~ 1% от общей микробной популяции, они не являются оптимальными для анализа субдоминантных видов или групп микробов [9], [10].

    В последние годы развитие технологий секвенирования следующего поколения (NGS) позволило провести углубленное секвенирование и анализ данных различных типов образцов окружающей среды [11] — [15] на более глубоком уровне, чем это возможно с помощью стандартных молекулярно-биологических методов [ 16].В частности, стратегии на основе Illumina, которые обеспечивают парное считывание одного и того же фрагмента ДНК, предлагают возможность мультиплексирования и генерируют большие объемы данных о последовательностях [16], [17]. Из коммерчески доступных платформ Illumina секвенатор MiSeq имеет наибольший потенциал для исследований последовательности 16S рДНК, поскольку он генерирует считывание последовательностей длиной до 600 п.н. и имеет соотношение производительности и стоимости, приемлемое для исследовательских лабораторий среднего размера [18]. Создание более длинных считываний последовательностей — важная особенность этой платформы, поскольку их легче отнести к таксономическим группам [19].Кроме того, поскольку платформа MiSeq Illumina позволяет проводить более глубокое секвенирование, чем традиционные подходы, она позволяет обнаруживать и анализировать субдоминантные виды или группы микробов [11]. Таким образом, комбинация этой технологии NGS с надежными наборами универсальных прокариотических праймеров позволит более точно определять соотношение бактерий к архей , чем традиционные подходы. В нескольких исследованиях были успешно применены прокариотические универсальные наборы праймеров и платформы NGS для анализа структуры микробного сообщества в экологических и клинических образцах, включая арктический морской лед, почву и мочевые катетеры [20] — [22].Однако филогенетическая специфичность и степень предвзятости этих прокариотических универсальных праймеров остаются неясными.

    В настоящем исследовании мы разработали универсальные наборы праймеров для специфического обнаружения областей V3-V4 прокариотической 16S рДНК, включая домены Bacteria и Archaea . Кроме того, мы разработали систему одновременного анализа для бактерий и Archaea на основе технологии секвенирования нового поколения Illumina MiSeq.

    Материалы и методы

    Образцы кала

    пробы фекалий были собраны у трех 11-месячных гибридных свиней (Ландрас × Большой белый × Дюрок), которые содержались на ферме, поддерживаемой префектурным университетом Киото.При разведении свиней соблюдались Руководящие принципы по уходу и использованию лабораторных животных Комитета по экспериментам на животных Префектурного университета Киото. Поскольку фекалии собирали неинвазивным способом, номер разрешения не требовался для исследования. Д-р К. Ушида и д-р С. Цучида (Университет префектуры Киото) любезно собрали пробы фекалий, а затем перевезли их в нашу лабораторию. Фекалии отдельных свиней были разделены на образцы по 5 г и затем заморожены при -80 ° C до использования.

    Экстракция ДНК

    Замороженные образцы фекалий размораживали на льду, 100 мг каждого образца суспендировали в 4 М тиоцианате гуанидия, 100 мМ Трис-HCl (pH 9,0) и 40 мМ ЭДТА, а затем образцы взбивали шариками из диоксида циркония с использованием FastPrep FP100A. прибор (MP Biomedicals, США). ДНК экстрагировали из суспензий, обработанных гранулами, с использованием Magtration System 12GC и серии GC MagDEA DNA 200 (Precision System Science, Япония). Концентрации ДНК оценивали спектрофотометрически на приборе ND-1000 (NanDrop Technologies, США), а конечную концентрацию образца ДНК доводили до 10 нг / мкл.

    Разработка универсального набора праймеров для прокариот

    Ранее опубликованные универсальные наборы праймеров для ПЦР, нацеленные на область V3-V4 бактериальной и архейной рДНК, были модифицированы для увеличения скорости обнаружения прокариот [23], [24]. Множественные выравнивания последовательностей 16S рДНК, полученных из базы данных DDBJ / GenBank / EMBL для выбранных эталонных организмов, проводили с использованием программы Clustal W с настройками по умолчанию [25]. На основании результатов выравнивания последовательности праймеров, которые давали наименьшее количество несовпадений в гипервариабельной области V3-V4 гена 16S рРНК, были выбраны в качестве универсальных прокариотических праймеров.Покрытие предыдущего и настоящего наборов праймеров проверялось по последовательностям хорошего качества (как определено на основе оценок Pintail в базе данных RDP) более 1200 п.н. и ≤1 несовпадений [26] в базе данных RDP (выпуск 10) с использованием функции Программа Probe Match [27]. Последовательности праймеров и связанные анализы ПЦР, использованные в этом исследовании, перечислены в таблице 1.

    Библиотека Illumina поколения

    Область V3-V4 16S рДНК была амплифицирована с использованием Pro341F / Pro805R для прокариот , 341F / R806 для бактерий и ARC344F / Arch806R для наборов праймеров Archaea (таблица 1).В дополнение к специфическим праймерам V3-V4 эти праймеры комплементарны стандартным прямым и обратным праймерам Illumina. Обратный праймер также содержал индексирующую последовательность из 6 пар оснований (таблица 1) для обеспечения мультиплексирования. Праймеры для амплификации были разработаны с адаптерами Illumina.

    Чтобы уменьшить образование ложных побочных продуктов в процессе амплификации, использовали метод Touchdown PCR для термоциклирования с количественным термоциклером Rotor-Gene Q (Qiagen, Германия) [28].Реакционная смесь (25 мкл) содержала 10 нг геномной ДНК, MightyAmp for Real Time (SYBR Plus) (Takara, Japan) и 0,25 мкМ каждого праймера. Условия реакции ПЦР для амплификации ДНК были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 35 циклов отжига, начиная с 65 ° C и заканчивая при 55 ° C в течение 15 секунд, и удлинение при 68 ° C в течение 30 сек. Температуру отжига снижали на 1 ° C каждый цикл до достижения 55 ° C, которое использовали для остальных циклов. Продукты ПЦР очищали на фильтровальной пластине MultiScreen PCR u96 (Merck Millipore, США) и анализировали с использованием набора Bioanalyzer DNA 1000 Chip Kit (Agilent Technologies, США) для обнаружения димеров праймеров и определения средней молекулярной массы каждого продукта.Очищенные продукты количественно оценивали с помощью количественной ПЦР в реальном времени (q-PCR) на количественном термоциклере Rotor-Gene Q с использованием MightyAmp for Real Time (SYBR Plus), 0,2 мкМ каждого праймера, которые были получены из адаптеров Illumina (Таблица 1 ) и серийно разведенную контрольную библиотеку PhiX (Illumina, США) в качестве стандарта. Условия реакции ПЦР для количественного определения каждого продукта ПЦР были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 30 циклов денатурации при 98 ° C в течение 10 секунд, отжиг при 60 ° C в течение 15 секунд и удлинение при 68 ° C в течение 30 сек.Этап количественной оценки был использован для определения концентрации амплифицированных библиотек и подтверждения наличия подходящих праймеров для секвенирования Illumina.

    Секвенирование и качественная фильтрация Illumina

    Каждый пул мультиплексированных библиотек был дополнен 25% -ным контролем phiX для улучшения базового вызова во время секвенирования, как рекомендовано Illumina для объединения двух библиотек. Секвенирование проводили с использованием цикла парных концов, 2 × 250 пар оснований, в системе секвенирования Illumina MiSeq и химии MiSeq Reagent Nano Kit версии 2 (500 циклов).После завершения секвенирования были выполнены анализ изображений, базовый вызов и оценка ошибок с использованием программного обеспечения Illumina Real-Time Analysis (версия 1.17.28).

    Было выполнено секвенирование парных концов с длиной считывания 251 п.н. После демультиплексирования наблюдалось четкое перекрытие считываний на парных концах. Это позволило объединить парные чтения вместе с программой fastq-join (http://code.google.com/p/ea-utils/). Для дальнейшего анализа были извлечены только те чтения, которые имели оценку значения качества (QV) ≥20 для более чем 99% последовательности.Все последовательности с неоднозначными базовыми вызовами были отброшены. Набор данных нуклеотидных последовательностей был депонирован в Архиве считывания последовательностей Банка данных ДНК Японии (DDBJ) под номером доступа DRA002295.

    Таксономический анализ на основе 16S рДНК

    Анализ считываний последовательностей был выполнен вручную с помощью инструмента Multiclassifier Project Ribosomal Database Project (RDP) [19], который доступен на веб-сайте RDP (http://rdp.cme.msu.edu/classifier/). Показания, полученные в формате FASTA, были отнесены к уровням классов с порогом достоверности 80%.

    Количественная ПЦР в реальном времени

    Количественное определение всех бактерий , архей , класса Thermoplasmata и класса Methanobacteria в кишечном тракте свиней проводили с использованием количественной ПЦР в реальном времени (кПЦР). Для получения стандартов для КПЦР очищенную геномную ДНК из Escherichia coli JCM 1649 T и Methanosarcina acetivorans DSM 2834 T амплифицировали с использованием пар праймеров 8F и 1510R или 21F и 1510R, соответственно (Таблица 1).Выделенную фекальную ДНК амплифицировали с использованием пар праймеров Pig Thermo F и Pig Thermo R или Pig Methano F и Pig Methano R (таблица 1). Реакционная смесь для ПЦР (25 мкл) содержала 20 нг геномной ДНК, 2 × буфер MightyAmp Ver.2 (Takara), 0,25 мкМ каждого праймера и 1,25 единицы ДНК-полимеразы MightyAmp (Takara). Условия цикла были следующими: начальная денатурация при 98 ° C в течение 2 минут, затем 35 циклов при 98 ° C в течение 10 с, 55 ° C в течение 15 секунд и 68 ° C в течение 1 минуты. Продукты амплификации (3 мкл) смешивали с 1 мкл красителя ДНК EZ-Vision One (Amresco Inc., USA), а затем разделены электрофорезом на 2% агарозных гелях для подтверждения получения единственного продукта с ожидаемой молекулярной массой. Продукты ПЦР очищали с использованием Econo Spin IIa (Gene Design, Япония), а затем клонировали в вектор pGEM-T Easy (Promega, США) для трансформации компетентных клеток E. coli HST08 Premium (Takara). Положительные трансформанты отбирали на агаре LB с добавлением ампициллина (100 мкг / мл) и одну колонию, которая была подтверждена с помощью ПЦР на наличие плазмиды с ожидаемой вставкой ДНК, выращивали в 5 мл среды LB с добавлением ампициллина (100 мкг / мл). ) с ночевкой.Культуру центрифугировали при 7610 × g для осаждения клеток, а затем плазмидную ДНК экстрагировали из клеток с использованием набора QIAprep Spin miniprep в соответствии с инструкциями производителя (Qiagen). Очищенную плазмиду количественно оценивали с помощью прибора ND-1000. Число копий 16S рДНК, присутствующих в препарате плазмиды, оценивали на основе концентрации ДНК и молекулярной массы pGEM-T Easy с целевой вставкой, как описано ранее [29]. Для расчета ожидаемый вес в дальтонах (г / моль) плазмидной конструкции сначала был определен с использованием уравнения: (длина двухцепочечного продукта в парах оснований [bp]) * (330 Da × 2 нуклеотида / bp) .Полученное значение затем делили на число Авогадро (6,022 × 10 23 ), чтобы получить количество граммов на молекулу, которое затем делили на общее количество препарата плазмиды, чтобы получить общее количество копий, присутствующих в образце. Очищенный раствор плазмидной ДНК серийно разводили в 10 раз с получением растворов в диапазоне от 10 3 до 10 7 копий / мкл. Серийно разведенные образцы использовали для построения стандартной кривой, которая использовалась для оценки количества копий целевой группы для каждой реакции qPCR.

    Q-PCR

    выполняли на количественном термоциклере Rotor-Gene Q с использованием SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara). Каждая реакционная смесь (20 мкл) содержала 20 нг экстрагированной ДНК и 0,2 мкМ каждого праймера. Условия цикла были следующими: начальная денатурация при 95 ° C в течение 30 секунд, затем 35 циклов при 95 ° C в течение 5 секунд, 60 ° C (все Bacteria и Archaea ), 58 ° C ( Thermoplasmata ). ) или 55 ° C ( Methanobacteria ) в течение 20 секунд и 72 ° C в течение 20 секунд.Для каждой реакции вместе с образцами анализировали положительный контроль и отрицательный водный контроль. Кривые плавления амплифицированной ДНК были построены для проверки специфичности реакции. Отношение общей популяции архей к численности прокариот оценивали по общему количеству копий бактерий и архей с использованием следующего уравнения: (1)

    , где A — общее количество копий Bacteria , а B — общее количество копий Archaea . Аналогичным образом соотношение Thermoplasmata к Methanobacteria также было рассчитано с использованием уравнения (1), где A представляет собой общее количество копий Thermoplasmata , а B представляет собой общее количество копий Methanobacteria .

    Результаты

    Разработка и покрытие универсального прокариотического праймера

    Мы модифицировали универсальные праймеры Pro341F и Pro805R, которые нацелены на гипервариабельную область V3 – V4 16S рДНК как Bacteria , так и Archaea , чтобы улучшить охват существующих последовательностей в базе данных RDP. Результаты анализа in-silico на специфичность праймера против последовательностей 16S рДНК вновь разработанного праймера и универсальных праймеров, специфичных для домена Bacteria и Archaea , представлены в таблице 2.Новый прокариотический универсальный праймер соответствовал приблизительно 98,0% последовательностей гена бактерий и 94,6% последовательностей гена рРНК архей , присутствующих в базе данных RDP (выпуск 10). Процент совпадения доменно-специфичных праймеров Bacteria (341F / R806) и Archaea (ARC344F / Arch806R), о которых ранее сообщалось, составлял 97,4% и 63,4% соответственно. Таким образом, охват последовательностей архей заново сконструированным универсальным праймером для прокариот был заметно выше, чем у праймера, специфичного для архей.

    NGS-анализ с использованием прокариотического универсального праймера

    Чтобы определить, можно ли одновременно выявить бактерий и Archaea с использованием недавно разработанного универсального прокариотического праймера, для образцов фекалий свиней был проведен NGS-анализ. Используя этот праймер и комбинацию платформы MiSeq, для каждой реакции секвенирования было получено в среднем 69 330 (± 20 482) считывания. Затем чтения были проанализированы на уровне класса с помощью инструмента RDP Multiclassifier (рис.1). Анализ NGS показал, что представители класса Clostridia были наиболее доминирующей таксономической группой во всех выборках. Как показано на рис. 1, чтения, соответствующие генам рРНК архей, составляли приблизительно от 1,2% до 3,2% прочтений прокариот для всех образцов, проанализированных с использованием прокариотического универсального праймера.

    Рис. 1. Результаты NGS-анализа на уровне класса микробного разнообразия в образцах фекалий свиней с использованием прокариотического универсального праймера.

    Гистограммы показывают таксономические профили, полученные для каждого из трех образцов фекалий свиней.Кончиками стрелок указаны считывания архей ( Methanobacteria ).

    https://doi.org/10.1371/journal.pone.0105592.g001

    Сравнение соотношения численности прокариот, определенного с помощью NGS и q-PCR

    Затем мы проанализировали, влияет ли смещение праймера на скорость обнаружения Archaea , рассчитав относительную численность последовательностей Bacteria по сравнению с последовательностями Archaea с помощью q-PCR. Коэффициент численности Archaea составляет примерно 1.От 1% до 2,6% всех прокариот, а соотношение численности бактерий и архей соответствовало результатам q-ПЦР (рис. 2). На основании этого результата было определено, что прокариотический универсальный праймер не проявлял сильного смещения праймеров и был способен точно отражать относительную численность Bacteria и Archaea .

    Рисунок 2. Относительные соотношения численности бактерий и Archaea , оцененные NGS с прокариотическим универсальным праймером.

    Результаты NGS-анализа трех образцов фекалий свиней сравниваются с результатами, полученными с помощью количественной ПЦР в реальном времени (кПЦР).

    https://doi.org/10.1371/journal.pone.0105592.g002

    Смещение ПЦР прокариотического универсального праймера для домена

    Бактерии

    Чтобы оценить влияние смещения праймеров на оценку численности таксономических групп бактерий, сравнивали результаты NGS-анализа, полученные с использованием бактериальных и недавно разработанных универсальных праймеров для прокариот.Расчетные соотношения численности таксономических групп бактерий на основе последовательностей, полученных с помощью универсального праймера для прокариот или бактерий, совпадали почти для всех доминирующих таксономических групп бактерий (соотношение численности> 0,001%) (рис. 3). Однако последовательности архей также были обнаружены в анализах, выполненных с помощью бактериального универсального праймера, что указывает на наличие систематической ошибки праймера, хотя частота обнаружения Archaea была снижена по сравнению с частотой, полученной с помощью универсального праймера для прокариот.Кроме того, частота обнаружения бактерий , принадлежащих к типу Verrucomicrobia , включая представителей классов Verrucomicrobiae и Opitutae , была выше в NGS-анализе с использованием универсального прокариотического праймера, чем с универсальным бактериальным праймером. (Рис. 4).

    Смещение ПЦР прокариотического универсального праймера для домена

    Archaea с помощью анализа NGS и q-PCR

    Для оценки влияния смещения праймеров на оценку численности двух основных таксономических групп архей (классы Thermoplasmata и Methanobacteria ), обнаруженных в анализе NGS, сравнивали результаты, полученные с использованием универсальных праймеров для архей и прокариот.Частота обнаружения представителей класса Methanobacteria была выше в NGS-анализе с использованием прокариотического универсального праймера, чем в анализе с универсальным праймером для архей (рис. 5).

    Наборы праймеров для конкретных классов

    для анализа q-PCR были также разработаны для оценки и сравнения относительных соотношений численности классов Thermoplasmata и Methanobacteria с анализом NGS. Соотношения численности этих двух классов в Archaea были сходными для анализа NGS с использованием прокариотического праймера и анализа q-PCR с использованием наборов класс-специфичных праймеров (рис.5), хотя относительная численность Methanobacteria была заметно выше при использовании прокариотического универсального праймера в первых образцах фекалий (рис. 5, свинья 1). Напротив, оценочные отношения численности классов Thermoplasmata и Methanobacteria с помощью q-PCR заметно различались по сравнению с NGS-анализом, выполненным с универсальным праймером для архей. В частности, соотношение Methanobacteria в анализе с универсальным праймером для архей было ниже, чем рассчитанное с использованием класс-специфичных праймеров в анализе q-PCR.

    Обсуждение

    В настоящем исследовании мы разработали и исследовали применимость прокариотического универсального праймера для одновременной амплификации бактериальной и архейной 16S рДНК с использованием секвенатора нового поколения Illumina MiSeq. Мы обнаружили, что недавно разработанный набор праймеров соответствует 98,0% последовательностей генов бактерий и 94,6% последовательностей рРНК архей в базе данных RDP и позволяет проводить одновременный анализ бактерий и архей в образцах фекалий свиней.Кроме того, прокариотический универсальный праймер имеет меньшую систематическую ошибку, чем ранее описанные универсальные праймеры, и эта характеристика имеет решающее значение для получения точных данных о микробном составе. Таким образом, ожидается, что недавно разработанный универсальный набор праймеров для прокариот позволит одновременно обнаруживать бактерий и Archaea в образцах окружающей среды и, следовательно, повысит стоимость и эффективность анализа структуры микробного сообщества с использованием технологии NGS.

    В NGS-анализах с использованием недавно разработанного универсального праймера для прокариот все идентифицированные таксономические группы также были обнаружены в анализе секвенирования с использованием универсального бактериального праймера; однако частота обнаружения нескольких таксономических групп заметно различалась между двумя наборами праймеров.Примечательно, что бактерии, принадлежащие к классам Verrucomicrobiae и Opitutae , обнаруживались в образцах фекалий почти в пять раз чаще с помощью универсального праймера для прокариот. Прокариотический универсальный праймер был разработан на основе универсального праймера (Uni340F, 5′-CCTACGGGRBGCASCAG-3 ‘), описанного Takai и Horikoshi [23]. Однако мы предположили, что представителей Verrucomicrobiae и Opitutae , которые все чаще признаются многочисленными видами в различных средах, было трудно обнаружить с использованием праймера 341F из-за несоответствия одного основания с геном 16S рРНК на 9-м основании от 5′-конец бактериального праймера 341F.Таким образом, мы модифицировали праймер Uni340F для удаления одиночного несоответствия (5′-CCTACGGG N BGCASCAG ‘) и подтвердили, что относительная скорость обнаружения Verrucomicrobiae и Opitutae с модифицированным прокариотическим универсальным праймером увеличилась в пять раз по сравнению с бактериальный универсальный праймер. Несколько исследований также продемонстрировали, что даже одно внутреннее несовпадение нуклеотидов в целевой области V3-V4 праймера может радикально изменить смещение ПЦР [_ENREF_1430-32]. Например, сравнение двух наборов праймеров, нацеленных на область V3-V4 гена 16S рРНК, показало, что были обнаружены совершенно разные фракции бактериального сообщества в активном иле [31], [33].Кроме того, различия в нуклеотидной последовательности праймера и области V3 сильно повлияли на структуру микробного сообщества [14]. Мы также обнаружили, что набор универсальных праймеров для прокариот дает разные соотношения численности для классов Thermoplasmata и Methanobacteria по сравнению с универсальным праймером для архей в NGS-анализе трех образцов фекалий свиней. Результаты q-PCR со специфическими праймерами для этих двух классов позволяют предположить, что универсальный праймер для прокариот более точно оценивает соотношения численности, чем универсальный праймер для архей.Однако для подтверждения этих результатов необходим анализ большего количества образцов окружающей среды с использованием обоих наборов праймеров.

    Анализ

    NGS с прокариотическим универсальным праймером показал, что представители класса Clostridia были наиболее доминирующей таксономической группой во всех образцах фекалий. Этот вывод согласуется с предыдущим анализом микрофлоры кишечника свиней на основе 16S рДНК, который показал, что Clostridiales были доминирующей бактериальной группой [34] — [36]. Кроме того, мы обнаружили, что гены рРНК архей составляют примерно 1.От 2% до 3,2% всех прокариотических прочтений в анализе с прокариотическим универсальным праймером. Все больше данных свидетельствует о том, что археи широко распространены в окружающей среде [37], [38], и хорошо известно, что археи являются частью кишечной микробиоты человека [38], хотя всесторонний анализ структуры сообщества архей еще не проведен. быть исполненным. Однако, насколько нам известно, это первый отчет об относительной численности архей в кишечном тракте свиней с использованием подхода NGS.В нескольких исследованиях изучали микробное разнообразие у свиней с использованием библиотек клонов DGGE и 16S рДНК [36], [39]. Например, относительно недавнее исследование изучало микробный состав аэрозолей в помещении для свиней и показало, что все обнаруженные последовательности архей принадлежали метаногенным архее, что согласуется с нашими нынешними находками обильных метанобактерий 16S рРНК в образцах фекалий свиней. [39].

    Для точного определения структуры микробного сообщества на основе разнообразия последовательностей рДНК 16S решающее значение имеет чувствительная, надежная и объективная ПЦР-амплификация 16S рДНК.В частности, высокий процент совпадения праймеров имеет решающее значение для предотвращения систематической ошибки при независимых от культивирования исследованиях структуры микробного сообщества. Настоящий анализ in-silico показал, что степень покрытия недавно разработанного универсального прокариотического праймера для последовательностей в базе данных RDP была примерно на 0,5% выше для Bacteria и на 0,8% выше для Archaea , чем у ранее описанных универсальных праймеров. [23], [40]. Мы также продемонстрировали, что разработанный здесь универсальный набор прокариотических праймеров имеет значительно меньшую систематическую ошибку, чем у большинства ранее применявшихся универсальных праймеров [23], [40].Ранее предполагалось, что наличие единственного несоответствия внутреннего праймера и матрицы в последовательности удлинения праймера может привести к занижению в 1000 раз числа копий гена, что приведет к недопредставлению таксономических групп, которые не соответствуют универсальной последовательности праймера [ 30]. Как описано выше в отношении повышенной скорости обнаружения Verrucomicrobiae и Opitutae , наш универсальный набор прокариотических праймеров идеально соответствовал большему количеству последовательностей гена 16S рРНК в исследованных образцах фекалий, чем бактериальный универсальный праймер, и, следовательно, показал меньшую систематическую ошибку (Таблица 2). ).Однако также возможно, что смещение праймера было связано с присущими ему свойствами отдельных последовательностей 16S рРНК в исследуемых образцах, включая содержание G + C, число копий и температуру плавления [41] — [43], а также особенности, на которые влияют условия амплификации, такие как вторичная структура и стабильность дуплекса. Таким образом, ожидается, что дальнейшая оптимизация условий ПЦР, таких как количество циклов амплификации, концентрации праймеров и геномной ДНК, а также тип и количество полимеразы, дополнительно снизит смещение ПЦР.

    В заключение, мы разработали универсальный набор прокариотических праймеров, который позволяет проводить одновременный анализ бактерий и архей с ограниченным смещением ПЦР. Процент соответствия недавно разработанного универсального прокариотического праймера для последовательностей в RDP выше, чем у ранее описанных универсальных праймеров, и результаты анализа NGS для образцов фекалий свиней показывают, что этот набор праймеров имеет повышенную чувствительность для членов классов Verrucomicrobiae. и Opitutae .Таким образом, при применении к технологии NGS ожидается, что разработанный здесь универсальный набор праймеров для прокариот обеспечит более полное понимание структуры микробного сообщества в образцах окружающей среды с сокращением времени и затрат.

    Благодарности

    Авторы благодарны доктору К. Ушиде и доктору С. Цучиде, Университет префектуры Киото, за их помощь в сборе образцов.

    Вклад авторов

    Задумал и спроектировал эксперименты: ST TH MN.Проведены опыты: СТ КН. Проанализированы данные: ST JT. Участвовал в написании рукописи: СТ МН.

    Список литературы

    1. 1.
      Перейра и Сильва М.К., Диас А.С., ван Эльзас Дж. Д., Саллес Дж. Ф. (2012) Пространственная и временная изменчивость сообществ архей, бактерий и грибов в сельскохозяйственных почвах. PLoS One 7: e51554.
    2. 2.
      Тан С., Мадиган М. Т., Ланоил Б. (2013) Разнообразие бактерий и архей в отложениях западного озера Бонни, Сухие долины Мак-Мердо, Антарктида.Appl Environ Microbiol 79: 1034–1038.
    3. 3.
      Патра А.К., Ю.З. (2012) Влияние эфирных масел на производство и ферментацию метана, а также на численность и разнообразие популяций микробов рубца. Appl Environ Microbiol 78: 4271–4280.
    4. 4.
      Цумстег А., Лустер Дж., Горанссон Х., Смиттенберг Р.Х., Бруннер И. и др. (2012) Бактериальная, архейная и грибковая сукцессия в переднем поле отступающего ледника. Microb Ecol 63: 552–564.
    5. 5.
      Winter C, Matthews B, Suttle CA (2013) Влияние изменений окружающей среды и пространственного расстояния на бактерий , архей и вирусов в субполярных и арктических водах.ISME J 7: 1507–1518.
    6. 6.
      Braker G, Ayala-del-Rio HL, Devol AH, Fesefeldt A, Tiedje JM (2001) Структура сообщества денитрификаторов, бактерий и Archaea вдоль окислительно-восстановительных градиентов в морских отложениях северо-запада Тихого океана с помощью анализа полиморфизма длины конечных рестрикционных фрагментов амплифицированные гены нитритредуктазы ( nirS ) и 16S рРНК. Appl Environ Microbiol 67: 1893–1901.
    7. 7.
      Zoetendal EG, Collier CT, Koike S, Mackie RI, Gaskins HR (2004) Молекулярно-экологический анализ микробиоты желудочно-кишечного тракта: обзор.J Nutr 134: 465–472.
    8. 8.
      Хань М., Лю Ф., Чжан Ф., Ли З., Лин Х. (2012) Бактериальные и архейные симбионты в губке Южно-Китайского моря Phakellia fusca : структура сообщества, относительная численность и популяции, окисляющие аммиак. Mar Biotechnol 14: 701–713.
    9. 9.
      Накаяма Дж., Танака С., Сонгджинда П., Татэяма А., Цубучи М. и др. (2007) Анализ кишечной микробиоты младенцев с помощью различных молекулярных подходов: к крупномасштабным эпидемиологическим исследованиям, коррелирующим развитие аллергии с кишечной микробиотой.J Intestinal Microbiol 21: 129–142.
    10. 10.
      Кертис Т.П., Хед И.М., Ланн М., Вудкок С., Шлосс П.Д. и др. (2006) Какова степень прокариотического разнообразия? Философия Trans R Soc Lond B Biol Sci 361: 2023–2037.
    11. 11.
      Caporaso JG, Paszkiewicz K, Field D, Knight R, Gilbert JA (2012) Западный Ла-Манш содержит устойчивый банк семян микробов. ISME J 6: 1089–1093.
    12. 12.
      Fouts DE, Szpakowski S, Purushe J, Torralba M, Waterman RC, et al.(2012) Секвенирование следующего поколения для определения разнообразия прокариот и грибов в рубце крупного рогатого скота. PLoS One 7: e48289.
    13. 13.
      Киёхара М., Коянаги Т., Мацуи Х., Ямамото К., Таке Х и др. (2012) Изменения в популяции микробиоты во время ферментации narezushi , выявленные с помощью анализа пиросеквенирования. Биологические науки, биотехнология и биохимия 76: 48–52.
    14. 14.
      Пинто А.Дж., Раскин Л. (2012) Смещения ПЦР искажают структуру бактериального и архейного сообщества в наборах данных пиросеквенирования.PLoS One 7: e43093.
    15. 15.
      Йерго Э., Лоуренс Дж. Р., Саншагрин С., Вайзер М. Дж., Корбер Д. Р. и др. (2012) Секвенирование следующего поколения микробных сообществ в реке Атабаска и ее притоках в связи с разработкой нефтеносных песков. Appl Environ Microbiol 78: 7626–7637.
    16. 16.
      Shokralla S, Spall JL, Gibson JF, Hajibabaei M (2012) Технологии секвенирования нового поколения для исследования ДНК в окружающей среде. Мол Экол 21: 1794–1805.
    17. 17.
      Перепел М.А., Смит М., Коупленд П., Отто Т.Д., Харрис С.Р. и др.(2012) Рассказ о трех платформах секвенирования следующего поколения: сравнение секвенсоров Ion Torrent, Pacific Biosciences и Illumina MiSeq. BMC Genomics 13: 341.
    18. 18.
      Kozich JJ, Westcott SL, Baxter NT, Highlander SK, Schloss PD (2013) Разработка стратегии двойного индекса секвенирования и конвейера курирования для анализа данных последовательности ампликонов на платформе секвенирования MiSeq Illumina. Appl Environ Microbiol 79: 5112–5120.
    19. 19.
      Ван Кью, Гаррити Дж. М., Тидже Дж. М., Коул Дж. Р. (2007) Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии.Appl Environ Microbiol 73: 5261–5267.
    20. 20.
      Bowman JS, Rasmussen S, Blom N, Deming JW, Rysgaard S и др. (2011) Структура микробного сообщества арктического многолетнего морского льда и поверхностной морской воды по данным 454 секвенирования гена 16S РНК. ISME J 6: 11–20.
    21. 21.
      Эйлерс К.Г., Дебенпорт С., Андерсон С., Фирер Н. (2012) Копаем глубже, чтобы найти уникальные микробные сообщества: сильное влияние глубины на структуру сообществ бактерий и архей в почве. Биология и биохимия почвы 50: 58–65.
    22. 22.
      Xu Y, Moser C, Al-Soud WA, Sorensen S, Hoiby N и др. (2012) Культурально-зависимые и независимые исследования микробного разнообразия на мочевых катетерах. J Clin Microbiol 50: 3901–3908.
    23. 23.
      Takai K, Horikoshi K (2000) Быстрое обнаружение и количественная оценка членов сообщества архей с помощью количественной ПЦР с использованием флуорогенных зондов. Appl Environ Microbiol 66: 5066–5072.
    24. 24.
      Herlemann DP, Labrenz M, Jurgens K, Bertilsson S, Waniek JJ и др.(2011) Переходы в бактериальных сообществах вдоль градиента солености 2000 км Балтийского моря. ISME J 5: 1571–1579.
    25. 25.
      Томпсон Д.Д., Хиггинс Д.Г., Гибсон Т.Дж. (1994) CLUSTAL W: повышение чувствительности последовательного последовательного последовательного взвешивания, штрафов за пропуски для конкретных позиций и выбора матрицы весов. Nucleic Acids Res 22: 4673–4680.
    26. 26.
      Накаяма Дж. (2010) Профилирование 16S рРНК желудочно-кишечной микробиоты на основе пиросеквенирования.Биологическая микрофлора 29: 83–96.
    27. 27.
      Майдак Б.Л., Коул Дж. Р., Лилберн Т. Г., Паркер К. Т. младший, Саксман П. Р. и др. (2001) RDP-II (Проект базы данных рибосом). Nucleic Acids Res 29: 173–174.
    28. 28.
      Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS (1991) ПЦР «Touchdown» для обхода ложного праймирования во время амплификации гена. Nucleic Acids Res 19: 4008.
    29. 29.
      Уилан Дж. А., Рассел Н. Б., Уилан М. А. (2003) Метод абсолютного количественного определения кДНК с использованием ПЦР в реальном времени.J Immunol Methods 278: 261–269.
    30. 30.
      Bru D, Martin-Laurent F, Philippot L (2008) Количественная оценка пагубного эффекта несоответствия одного праймера и матрицы с помощью ПЦР в реальном времени с использованием гена 16S рРНК в качестве примера. Appl Environ Microbiol 74: 1660–1663.
    31. 31.
      Клиндворт А., Прюсс Э., Швир Т., Пеплис Дж., Кваст С. и др. (2013) Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований и исследований разнообразия на основе секвенирования следующего поколения.Нуклеиновые кислоты Res 41: e1.
    32. 32.
      Wu JH, Hong PY, Liu WT (2009) Количественные эффекты положения и типа одиночного несоответствия на удлинение праймера одного основания. J Microbiol Methods 77: 267–275.
    33. 33.
      Fredriksson NJ, Hermansson M, Wilén B-M (2013) Выбор праймеров для ПЦР имеет большое влияние на оценки разнообразия и динамики бактериального сообщества на очистных сооружениях. PLoS ONE 8: e76431.
    34. 34.
      Лезер Т.Д., Аменувор Дж. З., Дженсен Т. К., Линдекрона Р. Х., Бой М. и др.(2002) Независимый от культуры анализ кишечных бактерий: новый взгляд на микробиоту желудочно-кишечного тракта свиней. Appl Environ Microbiol 68: 673–690.
    35. 35.
      Snell-Castro R, Godon JJ, Delgenès JP, Dabert P (2005) Характеристика микробного разнообразия в яме для хранения свиного навоза с использованием анализа последовательности малых субъединиц рДНК. FEMS Microbiol Ecol 52: 229–242.
    36. 36.
      Лю Ф, Ван С, Чжан Дж, Чжан Дж, Ян Х и др. (2009) Структура сообщества бактерий и архей в биогазовом реакторе, выявленная с помощью денатурирующего градиентного гель-электрофореза и анализа секвенирования 16S рДНК.J Appl Microbiol 106: 952–966.
    37. 37.
      Вреде С., Драйер А., Кокошка С., Хопперт М. (2012) Археи в симбиозах. Archaea 2012: 5

      .

    38. 38.
      Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI (2005) Бактериальный мутуализм хозяина в кишечнике человека. Наука 307: 1915–1920.
    39. 39.
      Nehmé B, Gilbert Y, Létourneau V, Forster RJ, Veillette M и др. (2009) Независимая от культуры характеристика биоразнообразия архей в биоаэрозолях для свиней.Appl Environ Microbiol 75: 5445–5450.
    40. 40.
      Yu Y, Lee C, Kim J, Hwang S (2005) Группоспецифичные наборы праймеров и зондов для обнаружения метаногенных сообществ с использованием количественной полимеразной цепной реакции в реальном времени. Biotechnol Bioeng 89: 670–679.
    41. 41.
      Фаррелли В., Рейни Ф.А., Стакебрандт Э. (1995) Влияние размера генома и числа копий гена ррн на ПЦР-амплификацию генов 16S рРНК из смеси видов бактерий. Appl Environ Microbiol 61: 2798–2801.
    42. 42.
      Fogel G, Collins C, Li J, Brunk C (1999) Размер прокариотического генома и количество копий рДНК SSU: оценка относительной численности микробов в смешанной популяции. Микробная экология 38: 93–113.
    43. 43.
      Исии К., Фукуи М. (2001) Оптимизация температуры отжига для уменьшения систематической ошибки, вызванной несоответствием праймеров в многопозиционной ПЦР. Appl Environ Microbiol 67: 3753–3755.
    44. 44.
      Muyzer G, de Waal EC, Uitterlinden AG (1993) Профилирование сложных микробных популяций с помощью анализа денатурирующего градиентного гель-электрофореза генов, амплифицированных полимеразной цепной реакцией, кодирующих 16S рРНК.Appl Environ Microbiol 59: 695–700.
    45. 45.
      Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA и др. (2011) Глобальные паттерны разнообразия 16S рРНК на глубине миллионов последовательностей на образец. Proc Natl Acad Sci U S A 108 Suppl 14516–4522.
    46. 46.
      Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Выделение и прямое полное определение нуклеотидов целых генов. Характеристика гена, кодирующего рибосомную РНК 16S. Nucleic Acids Res 17: 7843–7853.
    47. 47.
      Рейзенбах А.Л., Викхэм Г.С., Пейс Н.Р. (1994) Филогенетический анализ сообщества гипертермофильных розовых нитей в Octopus Spring, Йеллоустонский национальный парк. Appl Environ Microbiol 60: 2113–2119.
    48. 48.
      Raskin L, Stromley JM, Rittmann BE, Stahl DA (1994) Зонды гибридизации 16S рРНК, специфичные для группы, для описания природных сообществ метаногенов. Appl Environ Microbiol 60: 1232–1240.
    49. 49.
      Делонг Е.Ф. (1992) Археи в прибрежной морской среде.Proc Natl Acad Sci U S A 89: 5685–5689.

    Количественная оценка вредного влияния несоответствия одиночного праймера и матрицы с помощью ПЦР в реальном времени с использованием гена 16S рРНК в качестве примера Ген рРНК в качестве модельной ДНК-матрицы. Мы наблюдали, что наличие единственного ошибочного спаривания во второй половине последовательности удлинения праймера может привести к недооценке до 1000-кратного числа копий гена, в зависимости от праймера и положения ошибочного спаривания.

    ДНК-полимеразы катализируют добавление нуклеотидов к праймеру 3′-ОН, что определяется комплементарностью матричной ДНК. Основными характеристиками праймера, которые определяют эффективность и точность ПЦР, являются температура плавления, вторичные структуры и комплементарность между праймерами и целевой ДНК. Несоответствие между праймерами и целевой ДНК может влиять на стабильность дуплекса, что может затем препятствовать способности системы амплифицировать матричную ДНК. Эффекты несовпадений зависят от множества факторов, таких как длина олигонуклеотидов, а также природа и положение несовпадений.В нескольких исследованиях изучались эффекты несовпадения праймер-матрица на 3′-конце последовательности праймера, и было продемонстрировано, что ПЦР предотвращается одним несовпадающим основанием на 3′-конце (1, 3, 6, 8). Напротив, исследования влияния внутренних несоответствий проводятся реже, и считается, что такие несоответствия можно терпеть (8). Однако до сих пор неизвестно, в какой степени такие несовпадения могут повлиять на эффективность ПЦР.

    Поскольку во многих применениях ПЦР матричная ДНК представляет собой смесь гомологичных генов, важно выяснить, как несовпадение праймер-матрица может повлиять на точную интерпретацию результатов.В микробиологии наиболее распространенным примером амплификации гомологичных генов является амплификация гена 16S рРНК, который используется в качестве филогенетического маркера для исследования бактериального разнообразия в природных экосистемах (11, 15). За последние 20 лет 16S рРНК оказалась мощным маркером и позволила расширить известное бактериальное разнообразие (5). Однако в гене 16S рРНК самая длинная цепочка полностью консервативных оснований находится между положениями 788 и 798, и большинство абсолютно консервативных областей обнаруживаются в цепочках из менее чем 4 оснований (2).Следовательно, ни один существующий праймер, нацеленный на ген прокариотической 16S рРНК, не является универсальным, что может привести к дифференциальной амплификации в смеси матричной ДНК из сложной микробиоты, что приведет к искаженному представлению о микробном разнообразии (14).

    Целью этого исследования было использование ПЦР в реальном времени для количественной оценки влияния несовпадений праймер-матрица на эффективность ПЦР. Для этого в качестве модели использовали ген 16S рРНК и сравнивали эффекты несовпадений в различных положениях либо в последовательности универсальных праймеров 341F-534R (10, 16), либо в самой матричной ДНК.Число копий гена 16S рРНК определяли количественно с помощью ПЦР в реальном времени, что позволяет четко сравнивать эффективность амплификации между реакциями.

    Пагубный эффект несовпадения праймера с матрицей был всесторонне изучен путем внесения изменений оснований либо в последовательность праймера, либо в матричную последовательность, в которой происходит удлинение праймера, таким образом тестируя в общей сложности 21 праймер и 19 матриц ДНК. Поскольку процент G + C учитывается при расчете температуры плавления и во избежание изменения температуры отжига, несовпадения вносились только путем преобразования основания.Прямые праймеры 341F и обратные 534R с различными одноосновными изменениями были синтезированы, как показано в таблице 1. ДНК из трех бактериальных штаммов, для которых был секвенирован полный геном, то есть Pseudomonas aeruginosa PAO1, Agrobacterium tumefaciens C58 и Sinorhizobium meliloti 1021, использовали в качестве шаблонов. Теоретическое число копий гена 16S рРНК на нг матричной геномной ДНК рассчитывали по следующей формуле (Руководство Quanti Tect Sybr green PCR; Qiagen, Франция): (число копий 16S рРНК на нг) = (6.023 × 10 23 ) / (размер генома в парах оснований × 660 × 10 9 ) × (количество копий 16S рРНК на геном). Мы создали матрицы 16S рРНК с желаемыми изменениями оснований путем амплификации 16S рРНК из P. aeruginosa с ошибочно спаренными праймерами из таблицы 1. Полученные продукты ПЦР клонировали с использованием набора pGEM-T Easy (Promega, Франция). и наличие изменений оснований проверяли секвенированием с использованием набора для секвенирования цикла красителя-терминатора-1 (Beckman Coulter, Франция) и секвенатора Ceq 8000 (Beckman Coulter, Франция).Линеаризованные плазмиды, содержащие клонированные продукты ПЦР, затем использовали в качестве ДНК-матрицы для амплификации ПЦР в реальном времени с праймерами 341F и 534R.

    Количественная оценка копий 16S рРНК на нг матричной ДНК была основана на интенсивности флуоресценции зеленого красителя Sybr, который связывается с двухцепочечной ДНК. ПЦР в реальном времени проводили на системе обнаружения последовательностей ABI Prism 7900 HT (Applied Biosystems, Франция). 20 мкл смеси для ПЦР содержали 10 мкл мастер-смеси для ПЦР Absolute Sybr green ROX (ABgene, Франция), 1 мкМ каждого праймера и 1 мкМ каждого праймера.5 нг геномной ДНК или 0,05 нг плазмидной ДНК количественно определяют спектрофотометрией при 260 нм с использованием Bio-Photometer (Eppendorf, Германия). Термоциклирование выполняли, как описано ранее (9). Во все анализы также были включены контроли без матрицы. Кривые плавления получали после амплификации путем увеличения температуры от 80 ° C до 95 ° C. Стандартные кривые получали с использованием 10-кратных серийных разведений линеаризованной плазмиды, содержащей клонированные гены 16S рРНК из Pseudomonas aeruginosa PAO1.Для всех праймеров были выполнены три независимых количественных ПЦР и вычислено среднее значение. Продукты ПЦР в реальном времени подвергали электрофорезу в 2% агарозных гелях для проверки наличия единственной полосы ожидаемого размера из 174 пар оснований.

    В первом анализе одно и то же количество геномной ДНК было амплифицировано с различными наборами праймеров, показывающих одиночные несовпадения в разных положениях. ДНК из трех разных штаммов использовали в качестве матриц для решения вопроса о влиянии контекста на удлинение праймера путем изменения последовательности матрицы.Не было значительной разницы между теоретическим и наблюдаемым числом копий гена для любого штамма, когда универсальные праймеры 341F-534R использовались для количественной оценки гена 16S рРНК, что подтверждает наш анализ (данные не показаны).

    Неправильные прямой и обратный праймеры, показанные в таблице 1, использовали в комбинации с праймерами 534R и 341F соответственно. Влияние внутренних несовпадений различалось для прямого и обратного праймеров. Число копий 16S рРНК на нг ДНК снизилось с 10 6 до 10 3 при оценке с использованием несовместимых прямых праймеров (рис.1). Наблюдалась тенденция увеличения вредных эффектов на эффективность ПЦР, когда несовпадающие спаривания перемещались к 3′-концу праймера, что указывает на важность положения несовпадающего спаривания в последовательности праймера для стабильности отжига праймера. Таким образом, несовпадения, расположенные ближе к 3′-концу праймеров, были более критичными для эффективности ПЦР. Такая же тенденция наблюдалась для всех штаммов, что позволяет предположить, что генетический контекст не имел никакого эффекта. Для прямых праймеров одного несоответствия в положении -5, -6 или -8 3′-конца было достаточно, чтобы привести к занижению на 1 log числа копий гена.Напротив, не наблюдалось отрицательного эффекта для ошибочно спаренных обратных праймеров, когда несовпадения располагались более чем на 4 основания от 3′-конца, за исключением праймера R13C (рис. 1). Праймеры F11C, F14C и R13C оказали пагубное влияние на эффективность ПЦР, которое было больше, чем общая тенденция, что, вероятно, было связано с образованием шпилечной петли CC-GG путем преобразования оснований. В отличие от наших результатов, Kwok et al. (8) продемонстрировали, что одиночные внутренние несовпадения в одном из последних 4 оснований на 3′-конце не оказывали значительного влияния на выход продукта ПЦР.Такое наблюдаемое расхождение между результатами, вероятно, связано с тем, что конечный эффект несовпадений определяется множеством факторов, таких как длина праймера, природа и положение несовпадений, а также температура отжига праймеров. Например, праймер, использованный Kwok et al. (8) был олигонуклеотидом из 30 оснований, тогда как длины праймеров 341F и 534R составляли 17 и 19 оснований соответственно. Кроме того, условия низкой жесткости ПЦР использовали Kwok et al. (8), в то время как Исии и Фукуи (7) показали, что смещение из-за наличия несовпадений уменьшалось при более низких температурах.В отличие от единичных несовпадений, влияние нескольких внутренних несовпадений на ПЦР более широко описано в литературе. Таким образом, Guy et al. (4) сообщили, что несколько несоответствий снизили чувствительность обнаружения Giardia , о чем свидетельствует увеличение пороговых значений цикла. Недавно Sipos et al. (12), используя равную смесь двух штаммов в качестве матрицы, продемонстрировали предпочтительную амплификацию штамма, который полностью соответствовал последовательности праймера, по сравнению с амплификацией штамма, демонстрирующего три несовпадения вблизи 5′-конца последовательности праймера.Более выраженное снижение эффективности ПЦР с увеличением числа несовпадений было показано Smith et al. (13). Однако результаты настоящего исследования демонстрируют, что одно несовпадение внутреннего праймера с матрицей также может оказывать сильное отрицательное влияние на ПЦР, в зависимости от положения несовпадения и природы используемых праймеров.

    Чтобы проверить, были ли эффекты несовпадений на эффективность ПЦР симметричными, то есть было ли изменение основания на матрице ДНК эквивалентным изменению основания на праймере, то же количество линеаризованных плазмид, содержащих 16S рРНК, демонстрирующих единичные несовпадения различных положений в последовательности удлинения праймера, амплифицировали с праймерами 341F-534R (фиг.2). Этот подход также использовали для проверки того, что отрицательный эффект преобразования оснований в последовательности праймера, наблюдаемый в этом исследовании, не является результатом последующих модификаций вторичной структуры праймера. Аналогичная тенденция наблюдалась, когда изменения оснований были локализованы в матричной последовательности, соответствующей участкам удлинения праймера, и когда они были локализованы в последовательности праймера. Таким образом, в обоих случаях наблюдалось большее снижение эффективности ПЦР с несовпадениями в 3′-области (рис.2). Например, преобразование оснований в положении 16 (положение -1 на 3′-конце) на прямом праймере или на матричной ДНК привело в обоих случаях к занижению примерно на 3 логарифма числа копий гена (рис.1 и 2). Более сильные отрицательные эффекты преобразований оснований в положениях 11 и 14 на прямом праймере или в положении 13 на обратном праймере не наблюдались, когда такие же преобразования оснований были локализованы в матричной последовательности, тем самым подтверждая, что наличие петли шпильки в последовательности Последовательность праймера также может снизить эффективность ПЦР (рис.2). С другой стороны, некоторые преобразования оснований в матричной ДНК (например, F12G и R14G) имели больший отрицательный эффект, чем при локализации в последовательностях праймеров. Поэтому необходимы дальнейшие эксперименты, чтобы прояснить этот вопрос.

    В заключение, это исследование демонстрирует, что эффект одного несоответствия внутреннего праймера и матрицы варьирует, но может значительно снизить эффективность ПЦР в зависимости от его положения и от используемого праймера. Такой эффект несовпадения праймер-матрица может исказить данные, используемые при выводах о структуре микробного сообщества в подходе, основанном на ПЦР, из-за смещения в оценке относительных пропорций между группами, имеющими и не обладающими несовпадениями с праймерами. .В результате таксономические группы, которые не полностью соответствуют универсальным праймерам 16S рРНК, вероятно, недостаточно представлены в базах данных или в анализе отпечатков пальцев. Наличие несовпадений может также смещать анализы ПЦР в реальном времени, приводя к занижению фактического числа копий гена при измерении по идеально подобранному стандарту. Вместо того, чтобы допускать некоторые несоответствия между праймером и матрицей, а не увеличивать вырожденность праймера, это исследование предполагает, что использование нескольких наборов праймеров, нацеленных на разные подгруппы, может быть предпочтительным, когда полиморфизм последовательности целевого семейства генов высок.

    РИС. 1.

    Сравнение количества копий гена 16S рРНК в Pseudomonas aeruginosa PAO1 (A), Agrobacterium tumefaciens C58 (B) и Sinorhizobium meliloti 1021 (C), оценено с помощью ПЦР в реальном времени с использованием 341 ПЦР. 534R или неспаренные прямой и обратный праймеры в комбинации с праймерами 534R или 341F соответственно. Планки погрешностей показывают стандартные ошибки ( n = 3). Средние значения сравнивали с помощью теста t . Значительно разные числа копий гена ( P <0.05) обозначаются разными буквами.

    РИС. 2.

    Количественная оценка количества копий гена 16S рРНК с праймерами 341F-534R в плазмидах, содержащих мутагенную 16S рРНК, имеющую преобразование оснований в последовательностях прямого или обратного удлинения праймера. Планки погрешностей показывают стандартные ошибки ( n = 3). Средние значения сравнивали с помощью теста t . Значительно разные числа копий гена ( P <0,05) обозначены разными буквами. Н.Д .: не определено.

    ТАБЛИЦА 1.

    Праймеры, протестированные в нашем исследовании a

    БЛАГОДАРНОСТИ

    Мы благодарим Службу секвенирования и генотипирования (SSG) за предоставление технических возможностей.

    СНОСКИ

      • Получено 25 октября 2007 г.
      • Принято 3 января 2008 г.
    • Авторское право © Американское общество микробиологии, 2008 г. Таден, Р.J. S. Reis.
      2000. Дискриминация несовпадения 3′-нуклеотидов праймера с помощью ДНК-полимеразы Taq во время полимеразной цепной реакции. Анальный. Biochem. 284 : 11-18.

    • 2.

      Бейкер, Г. К., Дж. Дж. Смит и Д. А. Коуэн.
      2003. Обзор и повторный анализ доменно-специфичных праймеров 16S. J. Microbiol. Методы55 : 541-555.

    • 3.↵

      Дэй, П. Дж., Д. Бергстром, Р. П. Хаммер и Ф. Барани.
      1999. Аналоги нуклеотидов облегчают преобразование оснований с помощью праймеров 3′-ошибочного спаривания.Nucleic Acids Res.1999 : 1810-1818.

    • 4.↵

      Гай Р. А., К. Сяо и П. А. Хорген.
      2004. Анализ ПЦР в реальном времени для обнаружения и дифференциации генотипов Giardia lamblia в образцах стула. J. Clin. Microbiol.42 : 3317-3320.

    • 5.↵

      Хед, И. М., Дж. Р. Сондерс и Р. У. Пикап.
      1998. Микробная эволюция, разнообразие и экология: десятилетие анализа рибосомной РНК некультивируемых микроорганизмов.Microb. Ecol.35 : 1-21.

    • 6.↵

      Хуанг, М. М., Н. Арнхейм и М. Ф. Гудман.
      1992. Расширение ошибочных пар оснований с помощью ДНК-полимеразы Taq : значение для дискриминации одного нуклеотида в ПЦР. Nucleic Acids Res.20 : 4567-4573.

    • 7.↵

      Исии К. и М. Фукуи.
      2001. Оптимизация температуры отжига для уменьшения систематической ошибки, вызванной несоответствием праймеров в ПЦР с несколькими планшетами.Прил. Environ. Microbiol.67 : 3753-3755.

    • 8.↵

      Квок, С., Д. Э. Келлог, Н. МакКинни, Д. Спадич, Л. Годал, К. Левенсон и Дж. Дж. Снински.
      1990. Влияние несовпадений праймер-матрица на полимеразную цепную реакцию: исследования модели вируса иммунодефицита человека типа I. Nucleic Acids Res.18 : 999-1005.

    • 9.↵

      Лопес-Гутьеррес, Дж. К., С. Генри, С. Халлет, Ф. Мартин-Лоран, Г. Катру и Л.Филиппот.
      2004. Количественная оценка новой группы нитратредуцирующих бактерий в окружающей среде с помощью ПЦР в реальном времени. J. Microbiol. Методы 57 : 399-407.

    • 10.↵

      Муйзер, Г., С. Хоттентрагер, А. Теске и К. Уэйвер.
      1996. Денатурирующий градиентный гель-электрофорез 16S рДНК, амплифицированной с помощью ПЦР. Новый молекулярный подход к анализу генетического разнообразия смешанных микробных сообществ, стр. 3.4.4.1-3.4.4.22. В A. D. L. Akkermans, J.D. van Elsas и F. J. de Bruijn (редактор), Руководство по молекулярной микробной экологии. Kluwer Academic Publishing, Дордрехт, Нидерланды.

    • 11.↵

      Pace, N. R.
      1997. Молекулярный взгляд на микробное разнообразие и биосферу. Science276 : 734-740.

    • 12.↵

      Р. Сипос, А. Дж. Секели, М. Палатинский, С. Ревес, К. Мариалигети и М. Николауш.
      2007. Влияние несовпадения праймеров, температуры отжига и количества циклов ПЦР на анализ бактериального сообщества, направленного на ген 16S рРНК.FEMS Microbiol. Ecol.60 : 341-350.

    • 13.↵

      Смит, С., Л. Виджилант и П. А. Морин.
      2002. Влияние длины последовательности и несоответствия олигонуклеотидов на эффективность анализа 5′-экзонуклеаз. Nucleic Acids Res.30 : 111-121.

    • 14.↵

      фон Винцингероде, Ф., У. Б. Гобель и Э. Стакебрандт.
      1997. Определение микробного разнообразия в образцах окружающей среды: подводные камни анализа рРНК на основе ПЦР.FEMS Microbiol. Ред. 21 : 213-229.

    • 15.↵

      Уорд, Д. М., Р. Веллер и М. М. Бейтсон.
      1990. Последовательности 16S рРНК выявляют многочисленные некультивируемые микроорганизмы в естественном сообществе. Nature345 : 63-65.

    • 16.↵

      Ватанабэ К., Я. Кодама и С. Хараяма.
      2001. Разработка и оценка праймеров для ПЦР для амплификации фрагментов бактериальной 16S рибосомной ДНК, используемых для снятия отпечатков пальцев в сообществе.

    You may also like

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *